Incidental Mutation 'R1543:Wdr19'
ID171913
Institutional Source Beutler Lab
Gene Symbol Wdr19
Ensembl Gene ENSMUSG00000037890
Gene NameWD repeat domain 19
Synonyms
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65199696-65260415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65224690 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 418 (V418I)
Ref Sequence ENSEMBL: ENSMUSP00000144866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]
Predicted Effect probably benign
Transcript: ENSMUST00000041892
AA Change: V418I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890
AA Change: V418I

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203359
Predicted Effect probably benign
Transcript: ENSMUST00000203653
AA Change: V418I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890
AA Change: V418I

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204647
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Wdr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Wdr19 APN 5 65252299 missense probably benign 0.41
IGL01346:Wdr19 APN 5 65221739 splice site probably benign
IGL01761:Wdr19 APN 5 65215820 missense possibly damaging 0.60
IGL01845:Wdr19 APN 5 65225366 missense probably damaging 0.98
IGL01977:Wdr19 APN 5 65228569 missense probably benign
IGL02314:Wdr19 APN 5 65257120 missense probably benign 0.26
IGL02455:Wdr19 APN 5 65224759 missense probably benign 0.01
IGL02542:Wdr19 APN 5 65231071 missense probably benign
IGL02616:Wdr19 APN 5 65223581 missense probably damaging 0.97
IGL02661:Wdr19 APN 5 65245808 missense probably benign 0.06
IGL02927:Wdr19 APN 5 65252378 missense possibly damaging 0.80
IGL02958:Wdr19 APN 5 65212807 splice site probably null
IGL03083:Wdr19 APN 5 65230976 missense probably benign 0.01
IGL03332:Wdr19 APN 5 65227143 missense possibly damaging 0.89
detritus UTSW 5 65212891 missense possibly damaging 0.59
refuse UTSW 5 65228292 missense possibly damaging 0.64
R0924:Wdr19 UTSW 5 65256439 splice site probably benign
R1178:Wdr19 UTSW 5 65223865 missense probably damaging 0.98
R1229:Wdr19 UTSW 5 65256391 missense possibly damaging 0.94
R1434:Wdr19 UTSW 5 65223504 splice site probably benign
R1819:Wdr19 UTSW 5 65212891 missense possibly damaging 0.59
R1971:Wdr19 UTSW 5 65241160 splice site probably benign
R2190:Wdr19 UTSW 5 65244166 missense possibly damaging 0.89
R2274:Wdr19 UTSW 5 65240991 missense possibly damaging 0.62
R3106:Wdr19 UTSW 5 65202623 missense probably benign 0.20
R3753:Wdr19 UTSW 5 65224726 missense probably damaging 1.00
R3893:Wdr19 UTSW 5 65228292 missense possibly damaging 0.64
R4609:Wdr19 UTSW 5 65228542 missense possibly damaging 0.83
R5284:Wdr19 UTSW 5 65225409 missense probably damaging 1.00
R5328:Wdr19 UTSW 5 65244179 missense probably damaging 1.00
R5530:Wdr19 UTSW 5 65228219 missense probably benign
R5837:Wdr19 UTSW 5 65202957 missense probably benign 0.08
R5902:Wdr19 UTSW 5 65227139 missense probably benign 0.09
R6065:Wdr19 UTSW 5 65221713 missense probably benign
R6419:Wdr19 UTSW 5 65215893 missense possibly damaging 0.63
R6495:Wdr19 UTSW 5 65258123 missense probably benign 0.00
R6916:Wdr19 UTSW 5 65225334 missense possibly damaging 0.64
R7020:Wdr19 UTSW 5 65256314 missense probably damaging 0.99
R7190:Wdr19 UTSW 5 65240862 missense probably benign 0.35
X0028:Wdr19 UTSW 5 65244144 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGACAGTGCATAACTGACAGTAGC -3'
(R):5'- CCAAGGGTCTTGGTAATGGGACATC -3'

Sequencing Primer
(F):5'- GTGCATAACTGACAGTAGCCATTC -3'
(R):5'- GGGACATCAAATTTAGGCTTCCAG -3'
Posted On2014-04-13