Incidental Mutation 'R1543:Abcc6'
ID171921
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 6
SynonymsMrp6, DCC, Dyscalc1
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45967555-46030302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46016504 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 231 (R231G)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
Predicted Effect probably benign
Transcript: ENSMUST00000002850
AA Change: R231G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: R231G

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Meta Mutation Damage Score 0.1632 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCTGCTGAGTGTCCTTTACC -3'
(R):5'- AAGAGCTTCCCCTTCGAGTTGTTG -3'

Sequencing Primer
(F):5'- GAGTGTCCTTTACCAGGATCTC -3'
(R):5'- CTGAACTTCTGACTCCAGAGAG -3'
Posted On2014-04-13