Incidental Mutation 'R1595:Or10al3'
ID 175765
Institutional Source Beutler Lab
Gene Symbol Or10al3
Ensembl Gene ENSMUSG00000059964
Gene Name olfactory receptor family 10 subfamily AL member 3
Synonyms GA_x6K02T2PSCP-2159633-2160598, MOR263-7, Olfr119
MMRRC Submission 039632-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R1595 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 38007576-38012611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38012004 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 148 (A148S)
Ref Sequence ENSEMBL: ENSMUSP00000150099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080483] [ENSMUST00000213732]
AlphaFold Q7TRJ5
Predicted Effect probably benign
Transcript: ENSMUST00000080483
AA Change: A148S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000092919
Gene: ENSMUSG00000059964
AA Change: A148S

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 1.7e-5 PFAM
Pfam:7tm_1 47 296 3.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213732
AA Change: A148S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0901 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,153,944 (GRCm39) probably null Het
Abcc10 G T 17: 46,633,164 (GRCm39) P556H probably damaging Het
Abcc9 A T 6: 142,578,821 (GRCm39) D914E probably benign Het
Adgrf4 A G 17: 42,978,764 (GRCm39) V193A probably benign Het
Adm A T 7: 110,228,298 (GRCm39) T160S probably damaging Het
Ammecr1l T C 18: 31,905,173 (GRCm39) probably null Het
Angpt2 T C 8: 18,748,129 (GRCm39) D377G probably damaging Het
Ankfn1 A G 11: 89,313,593 (GRCm39) probably null Het
Arhgap30 T G 1: 171,235,909 (GRCm39) M761R probably benign Het
Asb4 T G 6: 5,390,692 (GRCm39) N28K probably damaging Het
Cd177 A T 7: 24,444,389 (GRCm39) D696E probably benign Het
Cd200 G A 16: 45,215,214 (GRCm39) T123I probably benign Het
Cfap70 A G 14: 20,497,604 (GRCm39) V50A probably benign Het
Chaf1b T C 16: 93,701,987 (GRCm39) probably null Het
Chgb A C 2: 132,635,657 (GRCm39) D533A probably benign Het
Col12a1 A G 9: 79,509,536 (GRCm39) Y3041H probably damaging Het
Crot T C 5: 9,024,186 (GRCm39) N337D probably benign Het
Csad G A 15: 102,086,217 (GRCm39) A51V probably damaging Het
Cstdc7 T C 18: 42,306,454 (GRCm39) M7T probably benign Het
Cyp2b9 A G 7: 25,900,332 (GRCm39) Y380C possibly damaging Het
Dpysl2 G T 14: 67,052,952 (GRCm39) A299E probably damaging Het
Efcc1 A G 6: 87,708,440 (GRCm39) E189G probably damaging Het
Egfr T C 11: 16,856,847 (GRCm39) I940T probably damaging Het
Etnk2 T G 1: 133,300,917 (GRCm39) L228R possibly damaging Het
Fitm2 A G 2: 163,311,610 (GRCm39) I201T probably benign Het
Foxo1 A T 3: 52,253,375 (GRCm39) M513L probably benign Het
Galnt16 A T 12: 80,637,410 (GRCm39) K379I probably damaging Het
Gm57858 C T 3: 36,073,146 (GRCm39) A379T probably damaging Het
Gtf2a1 T A 12: 91,556,323 (GRCm39) N6Y probably damaging Het
Kcnc1 G A 7: 46,077,010 (GRCm39) V271M probably benign Het
Klhdc8b T A 9: 108,328,362 (GRCm39) D30V probably damaging Het
Lrrc7 G A 3: 157,882,914 (GRCm39) Q448* probably null Het
Med29 T C 7: 28,091,928 (GRCm39) D54G probably damaging Het
Mfn2 T C 4: 147,979,153 (GRCm39) T60A probably benign Het
Mroh1 T C 15: 76,317,730 (GRCm39) probably benign Het
Mxd1 A T 6: 86,628,453 (GRCm39) V149E possibly damaging Het
Naip6 A T 13: 100,435,602 (GRCm39) Y974N probably damaging Het
Ndn C T 7: 61,998,256 (GRCm39) P34L probably benign Het
Nhsl1 G T 10: 18,402,096 (GRCm39) K1107N probably damaging Het
Nlrc3 T C 16: 3,783,166 (GRCm39) E81G probably benign Het
Or9e1 G T 11: 58,732,478 (GRCm39) M179I probably benign Het
Osbpl5 C T 7: 143,256,955 (GRCm39) V392M possibly damaging Het
Pcdhb22 T A 18: 37,653,506 (GRCm39) V401E probably damaging Het
Pcm1 T A 8: 41,762,672 (GRCm39) H1444Q probably damaging Het
Pdlim2 A G 14: 70,402,193 (GRCm39) Y308H probably damaging Het
Phf14 T G 6: 11,988,752 (GRCm39) L664R possibly damaging Het
Phkb T C 8: 86,753,182 (GRCm39) probably benign Het
Ptchd3 T A 11: 121,721,420 (GRCm39) F98I probably damaging Het
Ptprt C T 2: 161,652,469 (GRCm39) probably null Het
Rbp3 A T 14: 33,678,155 (GRCm39) H701L possibly damaging Het
Rgl1 T C 1: 152,550,774 (GRCm39) probably benign Het
Satb1 A T 17: 52,089,729 (GRCm39) S373T possibly damaging Het
Scn3a T A 2: 65,329,323 (GRCm39) Y769F probably damaging Het
Senp7 A G 16: 56,005,131 (GRCm39) I922V probably damaging Het
Serpina3g A G 12: 104,205,531 (GRCm39) E90G probably benign Het
Sh3rf2 C T 18: 42,244,353 (GRCm39) T273I probably damaging Het
Slc15a3 A G 19: 10,831,675 (GRCm39) T350A probably benign Het
Socs5 T C 17: 87,441,623 (GRCm39) C188R probably damaging Het
Tacr1 A G 6: 82,380,723 (GRCm39) T45A probably benign Het
Th A G 7: 142,450,745 (GRCm39) V117A probably benign Het
Thpo C A 16: 20,547,206 (GRCm39) D81Y probably damaging Het
Tmem229b-ps A G 10: 53,351,385 (GRCm39) noncoding transcript Het
Trpc4 A G 3: 54,223,236 (GRCm39) E724G probably benign Het
Ttn T C 2: 76,576,977 (GRCm39) T24639A probably damaging Het
Ulk4 A G 9: 120,873,904 (GRCm39) S1176P probably damaging Het
Urgcp T C 11: 5,667,447 (GRCm39) D297G probably damaging Het
Vmn1r168 G A 7: 23,240,620 (GRCm39) G159D probably damaging Het
Vmn1r67 A T 7: 10,181,597 (GRCm39) N226I probably benign Het
Vmn2r27 T C 6: 124,208,574 (GRCm39) E57G probably benign Het
Zdhhc14 G T 17: 5,543,831 (GRCm39) R37L probably benign Het
Zfp512b G A 2: 181,230,229 (GRCm39) T499I probably damaging Het
Zmym2 A T 14: 57,158,187 (GRCm39) K575N probably benign Het
Other mutations in Or10al3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Or10al3 APN 17 38,011,883 (GRCm39) missense probably damaging 1.00
IGL03339:Or10al3 APN 17 38,011,682 (GRCm39) missense probably damaging 0.99
R0092:Or10al3 UTSW 17 38,011,696 (GRCm39) missense probably damaging 0.98
R0207:Or10al3 UTSW 17 38,011,949 (GRCm39) nonsense probably null
R0378:Or10al3 UTSW 17 38,011,932 (GRCm39) missense probably damaging 1.00
R0408:Or10al3 UTSW 17 38,012,190 (GRCm39) missense probably benign
R0483:Or10al3 UTSW 17 38,012,188 (GRCm39) missense probably benign 0.01
R1901:Or10al3 UTSW 17 38,012,312 (GRCm39) missense probably damaging 1.00
R1902:Or10al3 UTSW 17 38,012,312 (GRCm39) missense probably damaging 1.00
R2845:Or10al3 UTSW 17 38,011,714 (GRCm39) missense probably damaging 1.00
R2846:Or10al3 UTSW 17 38,011,714 (GRCm39) missense probably damaging 1.00
R4356:Or10al3 UTSW 17 38,011,790 (GRCm39) missense probably damaging 0.97
R4381:Or10al3 UTSW 17 38,011,790 (GRCm39) missense probably damaging 0.97
R6744:Or10al3 UTSW 17 38,012,336 (GRCm39) nonsense probably null
R7674:Or10al3 UTSW 17 38,011,573 (GRCm39) missense probably benign 0.03
R7677:Or10al3 UTSW 17 38,011,957 (GRCm39) missense probably damaging 1.00
R7994:Or10al3 UTSW 17 38,012,326 (GRCm39) missense probably damaging 0.99
R8305:Or10al3 UTSW 17 38,012,389 (GRCm39) missense probably benign 0.10
R8512:Or10al3 UTSW 17 38,012,071 (GRCm39) missense probably damaging 1.00
R9300:Or10al3 UTSW 17 38,011,815 (GRCm39) missense probably damaging 1.00
R9760:Or10al3 UTSW 17 38,012,434 (GRCm39) missense probably damaging 1.00
Z1177:Or10al3 UTSW 17 38,011,944 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTCTCTCCTGGAGATTGGCTACAC -3'
(R):5'- AGATATGCAGAGAACTGCTGCCAC -3'

Sequencing Primer
(F):5'- AGATTGGCTACACTTGCTCTG -3'
(R):5'- CACAAAAATTGCAGCCTCATTTTGG -3'
Posted On 2014-04-24