Incidental Mutation 'R1583:Scrn1'
ID 177246
Institutional Source Beutler Lab
Gene Symbol Scrn1
Ensembl Gene ENSMUSG00000019124
Gene Name secernin 1
Synonyms 6330535A03Rik, SES1, 2810019K23Rik
MMRRC Submission 039620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R1583 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 54501173-54566489 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 54520769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 279 (V279E)
Ref Sequence ENSEMBL: ENSMUSP00000019268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019268]
AlphaFold Q9CZC8
Predicted Effect probably damaging
Transcript: ENSMUST00000019268
AA Change: V279E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019268
Gene: ENSMUSG00000019124
AA Change: V279E

Pfam:Peptidase_C69 45 236 3.4e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000203800
AA Change: V28E
Meta Mutation Damage Score 0.9100 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the secernin family of proteins. A similar protein in rat functions in regulation of exocytosis in mast cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,882,681 S691P probably benign Het
Adgrb3 T C 1: 25,226,831 probably null Het
Ankar A G 1: 72,679,555 probably benign Het
Aplf A T 6: 87,646,033 Y355N probably damaging Het
Bms1 A G 6: 118,389,389 probably benign Het
Catsperb T C 12: 101,463,114 I182T probably damaging Het
Cd300ld2 T C 11: 115,013,777 D88G probably benign Het
Cebpz T C 17: 78,934,752 N491S probably damaging Het
Crybg2 T C 4: 134,081,459 S1415P probably damaging Het
Ddc A G 11: 11,829,131 V331A probably benign Het
Decr2 T C 17: 26,083,024 E244G probably damaging Het
Dhrs11 A G 11: 84,823,117 M136T probably damaging Het
Eapp G A 12: 54,685,948 Q126* probably null Het
Fam111a T A 19: 12,587,778 V297D probably damaging Het
Fam84a G A 12: 14,150,408 A106V probably benign Het
Fbxo10 A C 4: 45,062,118 L136R probably damaging Het
Fbxo30 T A 10: 11,291,374 H613Q possibly damaging Het
Frk A T 10: 34,591,810 probably null Het
Gm10392 T A 11: 77,517,481 D104V probably benign Het
Gm960 T A 19: 4,652,171 K282N probably damaging Het
Gpn1 A G 5: 31,497,338 E78G possibly damaging Het
Hhip T C 8: 79,990,276 Y506C probably damaging Het
Hid1 G A 11: 115,356,750 S274L possibly damaging Het
Immp2l G T 12: 41,703,765 probably benign Het
Klhl21 T C 4: 152,009,624 F228L possibly damaging Het
Lamc1 T A 1: 153,243,478 probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Magi2 T C 5: 19,227,332 V15A probably benign Het
Map2k7 T C 8: 4,243,621 probably null Het
Mga T A 2: 119,963,960 H2590Q possibly damaging Het
Mlxip T C 5: 123,450,223 I238T possibly damaging Het
Mylk T A 16: 34,875,586 D230E probably benign Het
Nacad T A 11: 6,601,185 T669S probably benign Het
Nin C T 12: 70,031,738 M1691I probably benign Het
Nlrp4d C T 7: 10,382,237 A203T probably damaging Het
Olfr1204 T G 2: 88,852,262 F104C probably damaging Het
Olfr1301 A T 2: 111,754,425 M59L probably damaging Het
Olfr1495 A T 19: 13,768,510 H56L probably benign Het
Olfr201 A G 16: 59,269,031 V212A probably benign Het
Olfr433 T C 1: 174,042,480 F177L probably benign Het
Olfr729 C A 14: 50,148,774 M33I probably benign Het
Osbp C A 19: 11,977,829 Q282K probably benign Het
Osbpl2 A G 2: 180,148,463 S177G probably damaging Het
Pax1 A G 2: 147,366,255 H261R possibly damaging Het
Pcif1 A T 2: 164,886,727 L274F probably damaging Het
Pkhd1 A G 1: 20,117,825 S3420P probably benign Het
Prss3 A C 6: 41,377,627 probably benign Het
Ptk2b T C 14: 66,163,114 T751A possibly damaging Het
Pus10 T C 11: 23,673,239 V126A probably damaging Het
Rai14 A C 15: 10,587,916 D258E probably damaging Het
Rbp3 T C 14: 33,954,524 V143A possibly damaging Het
Sarm1 G A 11: 78,483,327 Q625* probably null Het
Scgb1b21 T G 7: 33,527,667 noncoding transcript Het
Sipa1l2 T C 8: 125,421,895 T1670A probably damaging Het
Slc9a4 A T 1: 40,600,962 I305F probably benign Het
Smarcc1 A G 9: 110,213,617 T918A probably damaging Het
Tas2r109 A T 6: 132,980,426 H180Q probably benign Het
Tas2r121 G A 6: 132,700,230 R260* probably null Het
Tenm3 T C 8: 48,279,074 D1249G probably benign Het
Tgtp1 C G 11: 48,987,530 G116A probably damaging Het
Tial1 A G 7: 128,443,910 Y317H probably damaging Het
Trim66 A T 7: 109,455,080 W1308R probably damaging Het
Ulk2 T G 11: 61,783,545 K878N possibly damaging Het
Zfp41 T A 15: 75,618,291 S31T possibly damaging Het
Other mutations in Scrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Scrn1 APN 6 54520709 missense possibly damaging 0.92
IGL00937:Scrn1 APN 6 54520733 missense probably benign 0.02
IGL01568:Scrn1 APN 6 54522754 unclassified probably benign
IGL02572:Scrn1 APN 6 54512201 missense probably benign 0.01
IGL03251:Scrn1 APN 6 54548337 nonsense probably null
IGL03279:Scrn1 APN 6 54548337 nonsense probably null
IGL03301:Scrn1 APN 6 54548337 nonsense probably null
IGL03307:Scrn1 APN 6 54548337 nonsense probably null
R1658:Scrn1 UTSW 6 54520806 missense probably benign
R1843:Scrn1 UTSW 6 54522841 missense possibly damaging 0.81
R2314:Scrn1 UTSW 6 54525646 missense probably benign 0.43
R4795:Scrn1 UTSW 6 54520769 missense possibly damaging 0.71
R4960:Scrn1 UTSW 6 54534422 missense probably damaging 1.00
R5420:Scrn1 UTSW 6 54512063 missense probably benign 0.15
R8057:Scrn1 UTSW 6 54520773 missense probably benign
R8340:Scrn1 UTSW 6 54534533 missense possibly damaging 0.81
R8544:Scrn1 UTSW 6 54522856 missense probably benign
R9465:Scrn1 UTSW 6 54525664 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agaaggaaaaaatgaaggacagaac -3'
Posted On 2014-04-24