Mutagenetix > Incidental Mutations

Incidental Mutation 'R1583:Adgrb3'

177226

Institutional Source

Beutler Lab

Gene Symbol

Adgrb3

Ensembl Gene

ENSMUSG00000033569

Gene Name

adhesion G protein-coupled receptor B3

Synonyms

Bai3, A830096D10Rik

MMRRC Submission

039620-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.451) question?

Stock #

R1583 (G1)

Quality Score

108

Status

Validated

Chromosome

Chromosomal Location

25067476-25829707 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 25226831 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000116231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]

Predicted Effect

probably null
Transcript: ENSMUST00000041838

SMART Domains

Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119680

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126096

Predicted Effect

probably null
Transcript: ENSMUST00000126626

SMART Domains

Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	273	7.3e-65	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134022

Predicted Effect

probably null
Transcript: ENSMUST00000135518

SMART Domains

Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000135518

SMART Domains

Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000146592

SMART Domains

Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
TSP1	87	136	2.1e-12	SMART
TSP1	141	191	7.97e-13	SMART
TSP1	196	246	6.28e-11	SMART
TSP1	251	301	1.48e-7	SMART
HormR	303	369	4.15e-20	SMART
Pfam:DUF3497	379	603	2.5e-52	PFAM
GPS	608	661	1.24e-21	SMART
Pfam:7tm_2	667	903	5.4e-66	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000151309

SMART Domains

Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:GAIN	589	794	1.1e-44	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	875	1143	2.7e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153568

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.2%
20x: 88.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,882,681	S691P	probably benign	Het
Ankar	A	G	1: 72,679,555		probably benign	Het
Aplf	A	T	6: 87,646,033	Y355N	probably damaging	Het
Bms1	A	G	6: 118,389,389		probably benign	Het
Catsperb	T	C	12: 101,463,114	I182T	probably damaging	Het
Cd300ld2	T	C	11: 115,013,777	D88G	probably benign	Het
Cebpz	T	C	17: 78,934,752	N491S	probably damaging	Het
Crybg2	T	C	4: 134,081,459	S1415P	probably damaging	Het
Ddc	A	G	11: 11,829,131	V331A	probably benign	Het
Decr2	T	C	17: 26,083,024	E244G	probably damaging	Het
Dhrs11	A	G	11: 84,823,117	M136T	probably damaging	Het
Eapp	G	A	12: 54,685,948	Q126*	probably null	Het
Fam111a	T	A	19: 12,587,778	V297D	probably damaging	Het
Fam84a	G	A	12: 14,150,408	A106V	probably benign	Het
Fbxo10	A	C	4: 45,062,118	L136R	probably damaging	Het
Fbxo30	T	A	10: 11,291,374	H613Q	possibly damaging	Het
Frk	A	T	10: 34,591,810		probably null	Het
Gm10392	T	A	11: 77,517,481	D104V	probably benign	Het
Gm960	T	A	19: 4,652,171	K282N	probably damaging	Het
Gpn1	A	G	5: 31,497,338	E78G	possibly damaging	Het
Hhip	T	C	8: 79,990,276	Y506C	probably damaging	Het
Hid1	G	A	11: 115,356,750	S274L	possibly damaging	Het
Immp2l	G	T	12: 41,703,765		probably benign	Het
Klhl21	T	C	4: 152,009,624	F228L	possibly damaging	Het
Lamc1	T	A	1: 153,243,478		probably null	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Magi2	T	C	5: 19,227,332	V15A	probably benign	Het
Map2k7	T	C	8: 4,243,621		probably null	Het
Mga	T	A	2: 119,963,960	H2590Q	possibly damaging	Het
Mlxip	T	C	5: 123,450,223	I238T	possibly damaging	Het
Mylk	T	A	16: 34,875,586	D230E	probably benign	Het
Nacad	T	A	11: 6,601,185	T669S	probably benign	Het
Nin	C	T	12: 70,031,738	M1691I	probably benign	Het
Nlrp4d	C	T	7: 10,382,237	A203T	probably damaging	Het
Olfr1204	T	G	2: 88,852,262	F104C	probably damaging	Het
Olfr1301	A	T	2: 111,754,425	M59L	probably damaging	Het
Olfr1495	A	T	19: 13,768,510	H56L	probably benign	Het
Olfr201	A	G	16: 59,269,031	V212A	probably benign	Het
Olfr433	T	C	1: 174,042,480	F177L	probably benign	Het
Olfr729	C	A	14: 50,148,774	M33I	probably benign	Het
Osbp	C	A	19: 11,977,829	Q282K	probably benign	Het
Osbpl2	A	G	2: 180,148,463	S177G	probably damaging	Het
Pax1	A	G	2: 147,366,255	H261R	possibly damaging	Het
Pcif1	A	T	2: 164,886,727	L274F	probably damaging	Het
Pkhd1	A	G	1: 20,117,825	S3420P	probably benign	Het
Prss3	A	C	6: 41,377,627		probably benign	Het
Ptk2b	T	C	14: 66,163,114	T751A	possibly damaging	Het
Pus10	T	C	11: 23,673,239	V126A	probably damaging	Het
Rai14	A	C	15: 10,587,916	D258E	probably damaging	Het
Rbp3	T	C	14: 33,954,524	V143A	possibly damaging	Het
Sarm1	G	A	11: 78,483,327	Q625*	probably null	Het
Scgb1b21	T	G	7: 33,527,667		noncoding transcript	Het
Scrn1	A	T	6: 54,520,769	V279E	probably damaging	Het
Sipa1l2	T	C	8: 125,421,895	T1670A	probably damaging	Het
Slc9a4	A	T	1: 40,600,962	I305F	probably benign	Het
Smarcc1	A	G	9: 110,213,617	T918A	probably damaging	Het
Tas2r109	A	T	6: 132,980,426	H180Q	probably benign	Het
Tas2r121	G	A	6: 132,700,230	R260*	probably null	Het
Tenm3	T	C	8: 48,279,074	D1249G	probably benign	Het
Tgtp1	C	G	11: 48,987,530	G116A	probably damaging	Het
Tial1	A	G	7: 128,443,910	Y317H	probably damaging	Het
Trim66	A	T	7: 109,455,080	W1308R	probably damaging	Het
Ulk2	T	G	11: 61,783,545	K878N	possibly damaging	Het
Zfp41	T	A	15: 75,618,291	S31T	possibly damaging	Het

Other mutations in Adgrb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Adgrb3	APN	1	25228500	missense	probably benign	0.09
IGL00507:Adgrb3	APN	1	25074715	missense	possibly damaging	0.93
IGL00828:Adgrb3	APN	1	25488119	missense	possibly damaging	0.73
IGL01285:Adgrb3	APN	1	25093787	missense	probably benign	0.32
IGL01309:Adgrb3	APN	1	25112271	missense	possibly damaging	0.69
IGL01540:Adgrb3	APN	1	25112171	splice site	probably null
IGL01608:Adgrb3	APN	1	25553774	missense	probably damaging	1.00
IGL01638:Adgrb3	APN	1	25559751	splice site	probably benign
IGL01657:Adgrb3	APN	1	25826493	missense	probably benign	0.03
IGL01666:Adgrb3	APN	1	25460751	missense	probably damaging	0.96
IGL01712:Adgrb3	APN	1	25826279	missense	probably benign
IGL01767:Adgrb3	APN	1	25559814	missense	probably benign	0.00
IGL01987:Adgrb3	APN	1	25101431	critical splice donor site	probably null
IGL02201:Adgrb3	APN	1	25420550	splice site	probably benign
IGL02584:Adgrb3	APN	1	25504984	missense	probably damaging	0.98
IGL02685:Adgrb3	APN	1	25084242	critical splice donor site	probably null
IGL02886:Adgrb3	APN	1	25504910	splice site	probably null
IGL02929:Adgrb3	APN	1	25553824	missense	probably benign	0.00
IGL03153:Adgrb3	APN	1	25531897	nonsense	probably null
IGL03165:Adgrb3	APN	1	25094394	missense	probably benign	0.05
IGL03227:Adgrb3	APN	1	25547475	missense	probably damaging	1.00
IGL03392:Adgrb3	APN	1	25504448	missense	probably damaging	0.99
schwach	UTSW	1	25111691	critical splice donor site	probably null
R0007:Adgrb3	UTSW	1	25111691	critical splice donor site	probably null
R0048:Adgrb3	UTSW	1	25101482	missense	probably benign	0.02
R0048:Adgrb3	UTSW	1	25101482	missense	probably benign	0.02
R0322:Adgrb3	UTSW	1	25221748	splice site	probably benign
R0442:Adgrb3	UTSW	1	25396470	missense	probably damaging	0.96
R0563:Adgrb3	UTSW	1	25547554	missense	probably damaging	0.99
R1168:Adgrb3	UTSW	1	25826199	missense	probably benign
R1252:Adgrb3	UTSW	1	25128828	missense	probably damaging	1.00
R1264:Adgrb3	UTSW	1	25559850	missense	probably damaging	0.97
R1543:Adgrb3	UTSW	1	25488088	missense	probably benign	0.01
R1577:Adgrb3	UTSW	1	25094183	missense	possibly damaging	0.51
R1581:Adgrb3	UTSW	1	25094072	missense	possibly damaging	0.94
R1653:Adgrb3	UTSW	1	25101503	missense	probably benign	0.09
R1725:Adgrb3	UTSW	1	25826300	missense	probably damaging	1.00
R1792:Adgrb3	UTSW	1	25228471	missense	probably damaging	1.00
R1827:Adgrb3	UTSW	1	25532577	missense	probably damaging	0.99
R1838:Adgrb3	UTSW	1	25084270	missense	probably damaging	1.00
R1869:Adgrb3	UTSW	1	25826438	missense	possibly damaging	0.83
R1971:Adgrb3	UTSW	1	25547444	missense	probably benign	0.02
R2005:Adgrb3	UTSW	1	25111718	missense	probably benign	0.25
R2134:Adgrb3	UTSW	1	25093957	missense	probably damaging	0.99
R2142:Adgrb3	UTSW	1	25068209	missense	probably damaging	1.00
R2268:Adgrb3	UTSW	1	25111817	missense	possibly damaging	0.79
R3740:Adgrb3	UTSW	1	25826454	missense	probably benign	0.00
R3877:Adgrb3	UTSW	1	25111825	missense	probably damaging	1.00
R4120:Adgrb3	UTSW	1	25094307	nonsense	probably null
R4344:Adgrb3	UTSW	1	25826748	missense	possibly damaging	0.61
R4363:Adgrb3	UTSW	1	25112222	missense	probably damaging	1.00
R4438:Adgrb3	UTSW	1	25831027	unclassified	probably benign
R4465:Adgrb3	UTSW	1	25094366	missense	probably damaging	1.00
R4480:Adgrb3	UTSW	1	25111748	missense	probably damaging	1.00
R4554:Adgrb3	UTSW	1	25084279	missense	probably damaging	1.00
R4557:Adgrb3	UTSW	1	25084279	missense	probably damaging	1.00
R4622:Adgrb3	UTSW	1	25826488	missense	probably damaging	0.99
R4713:Adgrb3	UTSW	1	25547532	missense	probably damaging	1.00
R4772:Adgrb3	UTSW	1	25531875	missense	probably damaging	1.00
R4890:Adgrb3	UTSW	1	25221827	missense	probably damaging	1.00
R5045:Adgrb3	UTSW	1	25074779	missense	probably damaging	1.00
R5061:Adgrb3	UTSW	1	25068128	utr 3 prime	probably benign
R5097:Adgrb3	UTSW	1	25826084	missense	probably damaging	1.00
R5227:Adgrb3	UTSW	1	25093952	missense	possibly damaging	0.55
R5241:Adgrb3	UTSW	1	25111790	missense	possibly damaging	0.85
R5328:Adgrb3	UTSW	1	25094275	missense	possibly damaging	0.90
R5372:Adgrb3	UTSW	1	25128859	missense	probably benign	0.01
R5703:Adgrb3	UTSW	1	25420559	missense	probably damaging	1.00
R5747:Adgrb3	UTSW	1	25826562	missense	probably damaging	1.00
R5998:Adgrb3	UTSW	1	25431501	splice site	probably null
R6006:Adgrb3	UTSW	1	25826531	missense	possibly damaging	0.85
R6077:Adgrb3	UTSW	1	25094000	nonsense	probably null
R6183:Adgrb3	UTSW	1	25094370	missense	probably damaging	0.98
R6190:Adgrb3	UTSW	1	25420647	missense	probably benign	0.01
R6249:Adgrb3	UTSW	1	25432558	missense	probably damaging	1.00
R6310:Adgrb3	UTSW	1	25111718	missense	probably benign	0.13
R6450:Adgrb3	UTSW	1	25420602	missense	probably benign
R6678:Adgrb3	UTSW	1	25460810	missense	possibly damaging	0.84
R6679:Adgrb3	UTSW	1	25131296	missense	probably benign	0.01
R6685:Adgrb3	UTSW	1	25111736	nonsense	probably null
R6730:Adgrb3	UTSW	1	25094294	missense	probably damaging	1.00
R6805:Adgrb3	UTSW	1	25826172	missense	possibly damaging	0.83
R6847:Adgrb3	UTSW	1	25093922	missense	probably benign	0.03
R6929:Adgrb3	UTSW	1	25111771	nonsense	probably null
R6953:Adgrb3	UTSW	1	25826511	missense	probably damaging	1.00
R7062:Adgrb3	UTSW	1	25826085	missense	possibly damaging	0.90
R7244:Adgrb3	UTSW	1	25131269	missense	probably damaging	1.00
R7292:Adgrb3	UTSW	1	25531876	missense	probably damaging	1.00
R7325:Adgrb3	UTSW	1	25532630	missense	probably benign	0.01
R7378:Adgrb3	UTSW	1	25531919	nonsense	probably null
R7489:Adgrb3	UTSW	1	25547505	missense	probably damaging	1.00
R7615:Adgrb3	UTSW	1	25098897	missense	probably damaging	1.00
R7623:Adgrb3	UTSW	1	25547548	missense	probably damaging	1.00
R7787:Adgrb3	UTSW	1	25432544	missense	probably damaging	1.00
R7837:Adgrb3	UTSW	1	25128834	missense	probably damaging	1.00
R8064:Adgrb3	UTSW	1	25420556	critical splice donor site	probably null
R8152:Adgrb3	UTSW	1	25221757	splice site	probably null
R8161:Adgrb3	UTSW	1	25093922	missense	probably benign	0.03
R8225:Adgrb3	UTSW	1	25826516	missense	probably benign	0.00
R8417:Adgrb3	UTSW	1	25488053	missense	probably benign	0.21
R8742:Adgrb3	UTSW	1	25226754	missense	probably benign	0.01
Z1088:Adgrb3	UTSW	1	25131271	missense	probably damaging	1.00
Z1176:Adgrb3	UTSW	1	25093914	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TTACTCCTTGGACCAGGCTCACAC -3'
(R):5'- GTGATGGGCTGTAACCAAGCATTTG -3'

Sequencing Primer
(F):5'- TTCTGAGGTTCAACAGCAGC -3'
(R):5'- GCTGTAACCAAGCATTTGAAACTC -3'

Posted On

2014-04-24