Incidental Mutation 'R1658:Rgs7'
Institutional Source Beutler Lab
Gene Symbol Rgs7
Ensembl Gene ENSMUSG00000026527
Gene Nameregulator of G protein signaling 7
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.760) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosomal Location175059087-175492500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 175079554 bp
Amino Acid Change Isoleucine to Valine at position 374 (I374V)
Ref Sequence ENSEMBL: ENSMUSP00000141380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027812] [ENSMUST00000192203] [ENSMUST00000192227] [ENSMUST00000194288] [ENSMUST00000194555] [ENSMUST00000195324] [ENSMUST00000195477]
Predicted Effect probably benign
Transcript: ENSMUST00000027812
AA Change: I374V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027812
Gene: ENSMUSG00000026527
AA Change: I374V

DEP 37 112 1.69e-26 SMART
G_gamma 252 316 4.56e-20 SMART
GGL 255 316 2.75e-27 SMART
RGS 333 448 9.08e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192203
SMART Domains Protein: ENSMUSP00000141284
Gene: ENSMUSG00000026527

Pfam:RGS 1 31 2.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192227
AA Change: I374V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142278
Gene: ENSMUSG00000026527
AA Change: I374V

DEP 37 112 1.69e-26 SMART
G_gamma 252 316 4.56e-20 SMART
GGL 255 316 2.75e-27 SMART
RGS 333 448 9.08e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193798
Predicted Effect probably benign
Transcript: ENSMUST00000194288
AA Change: I57V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141855
Gene: ENSMUSG00000026527
AA Change: I57V

RGS 16 131 9.08e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194555
AA Change: I374V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142180
Gene: ENSMUSG00000026527
AA Change: I374V

DEP 37 112 1.69e-26 SMART
G_gamma 252 316 4.56e-20 SMART
GGL 255 316 2.75e-27 SMART
RGS 333 448 9.08e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195324
AA Change: I374V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000141380
Gene: ENSMUSG00000026527
AA Change: I374V

DEP 37 112 7.7e-29 SMART
G_gamma 252 316 2.1e-24 SMART
GGL 255 316 1.8e-29 SMART
RGS 333 448 3.4e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195477
AA Change: I77V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142181
Gene: ENSMUSG00000026527
AA Change: I77V

RGS 36 151 9.08e-49 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit reduced exploration in a new environment, impaired glucose tolerance in males, and abnormal rod b-wave electrophysiology. Mice homozygous for a knock-out allele exhibit runting, delayed eye opening, and transient prolonged b-wave implicit time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Ugp2 G A 11: 21,333,774 P98S probably benign Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Rgs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Rgs7 APN 1 175086180 missense probably benign 0.04
IGL02334:Rgs7 APN 1 175189222 missense probably damaging 0.96
IGL02805:Rgs7 APN 1 175149696 missense probably damaging 1.00
IGL03169:Rgs7 APN 1 175270835 missense possibly damaging 0.75
R0269:Rgs7 UTSW 1 175270820 missense possibly damaging 0.81
R1161:Rgs7 UTSW 1 175079455 missense probably damaging 1.00
R1840:Rgs7 UTSW 1 175153148 missense probably damaging 0.99
R1944:Rgs7 UTSW 1 175153203 missense possibly damaging 0.88
R2064:Rgs7 UTSW 1 175121942 missense probably damaging 0.98
R2114:Rgs7 UTSW 1 175091073 missense probably damaging 1.00
R2116:Rgs7 UTSW 1 175091073 missense probably damaging 1.00
R3803:Rgs7 UTSW 1 175189219 missense probably benign 0.39
R5106:Rgs7 UTSW 1 175076850 missense possibly damaging 0.87
R6042:Rgs7 UTSW 1 175149660 missense probably damaging 0.99
R7652:Rgs7 UTSW 1 175093830 missense probably benign
R7689:Rgs7 UTSW 1 175121730 missense probably benign 0.33
R7814:Rgs7 UTSW 1 175076069 missense probably benign
R7884:Rgs7 UTSW 1 175149650 critical splice donor site probably null
Z1088:Rgs7 UTSW 1 175084020 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgagaagttcaagaccagcc -3'
Posted On2014-05-09