Mutagenetix > Incidental Mutations

Incidental Mutation 'R1670:Tgm3'

187522

Institutional Source

Beutler Lab

Gene Symbol

Tgm3

Ensembl Gene

ENSMUSG00000027401

Gene Name

transglutaminase 3, E polypeptide

Synonyms

TG E

MMRRC Submission

039706-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1670 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130012349-130050399 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 130041768 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 449 (E449*)

Ref Sequence

ENSEMBL: ENSMUSP00000105928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110299]

Predicted Effect

probably null
Transcript: ENSMUST00000110299
AA Change: E449*

SMART Domains

Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: E449*

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	5	118	8.3e-33	PFAM
TGc	265	357	6.4e-39	SMART
Pfam:Transglut_C	483	588	3.9e-26	PFAM
Pfam:Transglut_C	595	693	4.9e-24	PFAM

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.3%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	G	A	2: 130,712,379	P187S	probably damaging	Het
Abcc9	A	G	6: 142,594,722	V1497A	possibly damaging	Het
Adam15	T	C	3: 89,348,510		probably benign	Het
Angel2	T	A	1: 190,942,163	S371T	probably benign	Het
Atr	T	A	9: 95,861,456	N49K	probably benign	Het
Bace2	G	A	16: 97,412,135	M228I	probably damaging	Het
Bdp1	A	C	13: 100,027,433		probably null	Het
Calr	A	T	8: 84,844,119	D302E	probably benign	Het
Camta1	T	C	4: 151,079,771	D340G	probably benign	Het
Car11	C	T	7: 45,703,525	T236I	possibly damaging	Het
Cfap69	A	T	5: 5,586,409	S275T	probably benign	Het
Cib2	G	A	9: 54,548,369	R104W	probably damaging	Het
CN725425	T	C	15: 91,245,815	S294P	possibly damaging	Het
Coro7	G	A	16: 4,628,233	S876F	possibly damaging	Het
Cspg4	G	A	9: 56,897,403	V1833M	probably damaging	Het
Dennd6b	C	A	15: 89,185,337		probably benign	Het
Dhx30	A	T	9: 110,085,273	Y979N	possibly damaging	Het
Dnah8	A	T	17: 30,725,124	I1772F	probably damaging	Het
Dync2h1	A	T	9: 6,993,942	I3976N	possibly damaging	Het
Ebi3	T	C	17: 55,954,479	I125T	probably damaging	Het
Elfn2	C	T	15: 78,672,368	A660T	probably benign	Het
F12	C	T	13: 55,421,533	C209Y	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam126a	T	A	5: 23,999,991	M1L	possibly damaging	Het
Fgfr2	T	A	7: 130,180,457	D413V	probably damaging	Het
Gdf10	T	A	14: 33,932,043	I169N	possibly damaging	Het
Gdnf	T	C	15: 7,815,649	V41A	probably benign	Het
Gm9857	A	T	3: 108,940,162		probably benign	Het
Gpatch11	A	G	17: 78,839,100	E58G	possibly damaging	Het
Gpr55	A	G	1: 85,941,415	V148A	possibly damaging	Het
Gucy1b1	A	G	3: 82,045,460	I222T	probably benign	Het
Hnf4a	T	C	2: 163,562,576	S227P	probably damaging	Het
Hsfy2	A	G	1: 56,636,389	S330P	possibly damaging	Het
Ift122	T	C	6: 115,923,883	V1054A	probably benign	Het
Il27	T	A	7: 126,589,475	E175D	probably benign	Het
Lactb2	A	T	1: 13,660,417	S12T	probably damaging	Het
Lrfn2	T	C	17: 49,096,577	V576A	probably benign	Het
Mansc4	C	G	6: 147,075,191	R309T	possibly damaging	Het
Med12l	AACAGCA	AACAGCAACAGCA	3: 59,275,958		probably benign	Het
Mrpl16	C	T	19: 11,774,595	R240*	probably null	Het
Muc3	A	G	5: 137,143,995	V70A	probably benign	Het
Ndnf	A	G	6: 65,703,070	D111G	probably benign	Het
Nek4	T	C	14: 30,982,427	F688S	probably damaging	Het
Nkx2-6	T	A	14: 69,174,677	M98K	probably benign	Het
Nup188	T	C	2: 30,340,655	S1402P	probably benign	Het
Olfr1036	T	A	2: 86,075,250	V170D	probably benign	Het
Olfr1307	C	T	2: 111,944,919	C179Y	probably damaging	Het
Olfr205	A	T	16: 59,329,244	N88K	probably benign	Het
Olfr206	T	C	16: 59,345,427	I91M	possibly damaging	Het
Olfr330	A	T	11: 58,529,411	S192T	probably damaging	Het
Olfr418	T	A	1: 173,270,900	S242T	probably damaging	Het
Olfr556	A	G	7: 102,670,402	T161A	possibly damaging	Het
Parp10	A	T	15: 76,242,070	V306E	probably benign	Het
Pcnx3	A	G	19: 5,673,315	L1284P	probably damaging	Het
Pld1	A	T	3: 28,049,240	I365F	probably benign	Het
Pnisr	A	G	4: 21,865,893	D294G	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Ptprn2	A	C	12: 116,722,172	T84P	possibly damaging	Het
Rln1	C	T	19: 29,332,068	E104K	possibly damaging	Het
Rnf38	A	G	4: 44,138,681	S271P	probably damaging	Het
Rngtt	A	G	4: 33,368,660	T398A	probably benign	Het
Rprd2	G	T	3: 95,764,803	T1096K	probably damaging	Het
Sema3e	C	T	5: 14,162,185		probably benign	Het
Sema5a	T	A	15: 32,548,799	C140S	probably damaging	Het
Shpk	A	C	11: 73,222,931	D390A	probably benign	Het
Slc22a20	C	T	19: 5,972,848		probably benign	Het
Steap2	A	G	5: 5,677,393	V314A	possibly damaging	Het
Stxbp5l	A	G	16: 37,290,927		probably null	Het
Tmem68	A	C	4: 3,560,627	L186V	probably damaging	Het
Ttc41	T	A	10: 86,776,252	W1130R	possibly damaging	Het
Ttpal	T	C	2: 163,615,366	F253L	possibly damaging	Het
Vmn2r99	G	T	17: 19,362,252	V40F	probably benign	Het
Xkr9	G	A	1: 13,700,943	V228M	probably damaging	Het
Zc3h7b	C	T	15: 81,777,067	A369V	probably benign	Het

Other mutations in Tgm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Tgm3	APN	2	130038413	missense	probably damaging	1.00
IGL00924:Tgm3	APN	2	130038374	missense	probably damaging	1.00
IGL01469:Tgm3	APN	2	130024494	missense	probably damaging	1.00
IGL01722:Tgm3	APN	2	130044568	missense	probably damaging	0.99
IGL01787:Tgm3	APN	2	130047740	missense	possibly damaging	0.85
IGL02269:Tgm3	APN	2	130024518	missense	probably benign	0.02
IGL02437:Tgm3	APN	2	130030041	splice site	probably null
IGL02449:Tgm3	APN	2	130038609	critical splice donor site	probably null
IGL02992:Tgm3	APN	2	130041979	missense	probably damaging	1.00
tortellini	UTSW	2	130024585	critical splice donor site	probably benign
ANU74:Tgm3	UTSW	2	130048390	missense	probably damaging	1.00
R0523:Tgm3	UTSW	2	130044662	critical splice donor site	probably null
R0833:Tgm3	UTSW	2	130026682	splice site	probably benign
R0834:Tgm3	UTSW	2	130026757	missense	probably benign	0.00
R0836:Tgm3	UTSW	2	130026682	splice site	probably benign
R0940:Tgm3	UTSW	2	130012406	missense	probably benign	0.00
R1354:Tgm3	UTSW	2	130041898	missense	probably benign
R1642:Tgm3	UTSW	2	130047782	missense	probably damaging	1.00
R1715:Tgm3	UTSW	2	130026814	critical splice donor site	probably null
R1944:Tgm3	UTSW	2	130029969	missense	probably damaging	0.99
R2104:Tgm3	UTSW	2	130037483	missense	probably benign	0.39
R3416:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R3417:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R4231:Tgm3	UTSW	2	130044589	nonsense	probably null
R4296:Tgm3	UTSW	2	130038413	missense	possibly damaging	0.77
R4794:Tgm3	UTSW	2	130041955	missense	probably benign	0.00
R4948:Tgm3	UTSW	2	130048320	missense	probably benign	0.00
R5034:Tgm3	UTSW	2	130037484	missense	possibly damaging	0.95
R5144:Tgm3	UTSW	2	130048282	missense	possibly damaging	0.95
R5786:Tgm3	UTSW	2	130026784	nonsense	probably null
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6182:Tgm3	UTSW	2	130025301	nonsense	probably null
R6219:Tgm3	UTSW	2	130038610	critical splice donor site	probably null
R6901:Tgm3	UTSW	2	130041970	missense	possibly damaging	0.95
R6969:Tgm3	UTSW	2	130042029	missense	probably benign	0.06
R6980:Tgm3	UTSW	2	130026777	missense	probably benign	0.17
R7282:Tgm3	UTSW	2	130024561	missense	probably benign	0.00
R7317:Tgm3	UTSW	2	130048291	missense	probably benign	0.09
R7513:Tgm3	UTSW	2	130024404	missense	probably benign	0.00
R7517:Tgm3	UTSW	2	130041764	missense	probably benign	0.01
R7793:Tgm3	UTSW	2	130012410	critical splice donor site	probably null
R7822:Tgm3	UTSW	2	130041899	missense	probably benign	0.00
R7955:Tgm3	UTSW	2	130038480	missense	probably benign
X0065:Tgm3	UTSW	2	130024510	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ACTTGATTGAAAAGGGACCACAGCC -3'
(R):5'- GGGACAGACTGACTTCTTTGCCTAC -3'

Sequencing Primer
(F):5'- CTGGCCTGGAAGCCTTATAC -3'
(R):5'- ACTGCCAGTATCCCCGTG -3'

Posted On

2014-05-09