Incidental Mutation 'R0084:Serpina1f'
ID19823
Institutional Source Beutler Lab
Gene Symbol Serpina1f
Ensembl Gene ENSMUSG00000021081
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1F
Synonymsepserin, 0610012A11Rik
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103688044-103695529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103693588 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 145 (V145A)
Ref Sequence ENSEMBL: ENSMUSP00000113736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021490] [ENSMUST00000117053] [ENSMUST00000118101]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021490
AA Change: V145A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021490
Gene: ENSMUSG00000021081
AA Change: V145A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117053
AA Change: V145A

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112533
Gene: ENSMUSG00000021081
AA Change: V145A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 354 1.23e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118101
AA Change: V145A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113736
Gene: ENSMUSG00000021081
AA Change: V145A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Serpina1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Serpina1f APN 12 103691869 missense probably benign 0.02
IGL00757:Serpina1f APN 12 103693462 missense probably damaging 1.00
IGL01123:Serpina1f APN 12 103694006 missense possibly damaging 0.47
IGL01695:Serpina1f APN 12 103693684 missense probably damaging 1.00
IGL01791:Serpina1f APN 12 103693502 missense probably damaging 1.00
IGL01868:Serpina1f APN 12 103693445 missense probably benign 0.24
IGL02135:Serpina1f APN 12 103693715 missense possibly damaging 0.90
IGL03025:Serpina1f APN 12 103693546 missense probably damaging 0.99
IGL03331:Serpina1f APN 12 103690891 missense probably benign 0.04
R0492:Serpina1f UTSW 12 103693567 missense possibly damaging 0.72
R0893:Serpina1f UTSW 12 103693835 missense probably damaging 0.97
R2202:Serpina1f UTSW 12 103693396 missense possibly damaging 0.75
R3974:Serpina1f UTSW 12 103693571 nonsense probably null
R4179:Serpina1f UTSW 12 103691920 missense probably benign 0.08
R4736:Serpina1f UTSW 12 103693546 missense probably damaging 0.97
R4948:Serpina1f UTSW 12 103689751 missense probably damaging 1.00
R5092:Serpina1f UTSW 12 103693550 missense probably damaging 1.00
R5416:Serpina1f UTSW 12 103693944 missense possibly damaging 0.68
R5887:Serpina1f UTSW 12 103689787 missense possibly damaging 0.85
R5887:Serpina1f UTSW 12 103693631 nonsense probably null
R6413:Serpina1f UTSW 12 103693694 missense probably damaging 1.00
R6566:Serpina1f UTSW 12 103693535 missense probably damaging 1.00
R7371:Serpina1f UTSW 12 103689827 missense probably damaging 0.96
R7419:Serpina1f UTSW 12 103689842 missense probably damaging 1.00
R7527:Serpina1f UTSW 12 103691908 missense probably benign 0.16
Z1176:Serpina1f UTSW 12 103691866 missense not run
Predicted Primers PCR Primer
(F):5'- TTCACCACAGCCAGGAATGTATCAC -3'
(R):5'- TCCCCGATTAGAGTCATTGCTGCC -3'

Sequencing Primer
(F):5'- AGGAATGTATCACTCTCCAGGTTC -3'
(R):5'- GATTAGAGTCATTGCTGCCATTTC -3'
Posted On2013-04-11