Incidental Mutation 'R6413:Serpina1f'
ID514825
Institutional Source Beutler Lab
Gene Symbol Serpina1f
Ensembl Gene ENSMUSG00000021081
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1F
Synonymsepserin, 0610012A11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location103688044-103695529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103693694 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 110 (I110F)
Ref Sequence ENSEMBL: ENSMUSP00000113736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021490] [ENSMUST00000117053] [ENSMUST00000118101]
Predicted Effect probably damaging
Transcript: ENSMUST00000021490
AA Change: I110F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021490
Gene: ENSMUSG00000021081
AA Change: I110F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117053
AA Change: I110F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112533
Gene: ENSMUSG00000021081
AA Change: I110F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 354 1.23e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118101
AA Change: I110F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113736
Gene: ENSMUSG00000021081
AA Change: I110F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Serpina1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Serpina1f APN 12 103691869 missense probably benign 0.02
IGL00757:Serpina1f APN 12 103693462 missense probably damaging 1.00
IGL01123:Serpina1f APN 12 103694006 missense possibly damaging 0.47
IGL01695:Serpina1f APN 12 103693684 missense probably damaging 1.00
IGL01791:Serpina1f APN 12 103693502 missense probably damaging 1.00
IGL01868:Serpina1f APN 12 103693445 missense probably benign 0.24
IGL02135:Serpina1f APN 12 103693715 missense possibly damaging 0.90
IGL03025:Serpina1f APN 12 103693546 missense probably damaging 0.99
IGL03331:Serpina1f APN 12 103690891 missense probably benign 0.04
R0084:Serpina1f UTSW 12 103693588 missense possibly damaging 0.82
R0492:Serpina1f UTSW 12 103693567 missense possibly damaging 0.72
R0893:Serpina1f UTSW 12 103693835 missense probably damaging 0.97
R2202:Serpina1f UTSW 12 103693396 missense possibly damaging 0.75
R3974:Serpina1f UTSW 12 103693571 nonsense probably null
R4179:Serpina1f UTSW 12 103691920 missense probably benign 0.08
R4736:Serpina1f UTSW 12 103693546 missense probably damaging 0.97
R4948:Serpina1f UTSW 12 103689751 missense probably damaging 1.00
R5092:Serpina1f UTSW 12 103693550 missense probably damaging 1.00
R5416:Serpina1f UTSW 12 103693944 missense possibly damaging 0.68
R5887:Serpina1f UTSW 12 103689787 missense possibly damaging 0.85
R5887:Serpina1f UTSW 12 103693631 nonsense probably null
R6566:Serpina1f UTSW 12 103693535 missense probably damaging 1.00
R7371:Serpina1f UTSW 12 103689827 missense probably damaging 0.96
R7419:Serpina1f UTSW 12 103689842 missense probably damaging 1.00
R7527:Serpina1f UTSW 12 103691908 missense probably benign 0.16
R7943:Serpina1f UTSW 12 103693690 missense probably damaging 0.98
R8249:Serpina1f UTSW 12 103693768 missense probably damaging 1.00
R8270:Serpina1f UTSW 12 103693498 missense probably damaging 1.00
Z1176:Serpina1f UTSW 12 103691866 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CCTGACTGCTGTCTGTAAAGTTG -3'
(R):5'- AGCATTGATCCCTTCCAGTGC -3'

Sequencing Primer
(F):5'- CTGTAAAGTTGATGGAGATCATGTC -3'
(R):5'- GGAAGGTGGCTCTTACCATC -3'
Posted On2018-05-04