Incidental Mutation 'R0084:Scube3'
ID19829
Institutional Source Beutler Lab
Gene Symbol Scube3
Ensembl Gene ENSMUSG00000038677
Gene Namesignal peptide, CUB domain, EGF-like 3
Synonyms
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28142316-28174852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28162961 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 320 (D320E)
Ref Sequence ENSEMBL: ENSMUSP00000038366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043503]
Predicted Effect probably benign
Transcript: ENSMUST00000043503
AA Change: D320E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038366
Gene: ENSMUSG00000038677
AA Change: D320E

DomainStartEndE-ValueType
low complexity region 9 15 N/A INTRINSIC
EGF_CA 29 69 5.23e-9 SMART
EGF_CA 70 111 1.2e-8 SMART
EGF_CA 112 152 1.14e-9 SMART
EGF 160 198 6.65e-2 SMART
EGF 200 237 7.95e0 SMART
EGF 239 276 7.76e-3 SMART
EGF_CA 277 317 7.63e-11 SMART
EGF_CA 318 356 7.01e-10 SMART
EGF_CA 357 398 6.8e-8 SMART
Pfam:GCC2_GCC3 642 689 8.6e-15 PFAM
Pfam:GCC2_GCC3 696 743 4.2e-17 PFAM
Pfam:GCC2_GCC3 752 799 5.8e-17 PFAM
CUB 804 916 1.09e-16 SMART
Blast:CUB 942 988 8e-15 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000132670
AA Change: D236E
SMART Domains Protein: ENSMUSP00000117490
Gene: ENSMUSG00000038677
AA Change: D236E

DomainStartEndE-ValueType
EGF_like 1 28 1.2e-1 SMART
EGF_CA 29 69 1.14e-9 SMART
EGF 77 115 6.65e-2 SMART
EGF 117 154 7.95e0 SMART
EGF 156 193 7.76e-3 SMART
EGF_CA 194 234 7.63e-11 SMART
EGF_CA 235 273 7.01e-10 SMART
EGF_CA 274 315 6.8e-8 SMART
Pfam:GCC2_GCC3 559 606 1.8e-17 PFAM
Pfam:GCC2_GCC3 615 662 4.2e-17 PFAM
CUB 667 779 1.09e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148342
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal peptide, complement subcomponents C1r/C1s, Uegf, bone morphogenetic protein-1 and epidermal growth factor-like domain containing protein family. Overexpression of this gene in human embryonic kidney cells results in secretion of a glycosylated form of the protein that forms oligomers and tethers to the cell surface. This gene is upregulated in lung cancer tumor tissue compared to healthy tissue and is associated with loss of the epithelial marker E-cadherin and with increased expression of vimentin, a mesenchymal marker. In addition, the protein encoded by this gene is a transforming growth factor beta receptor ligand, and when secreted by cancer cells, it can be cleaved in vitro to release the N-terminal epidermal growth factor-like repeat domain and the C-terminal complement subcomponents C1r/C1s domain. Both the full length protein and C-terminal fragment can bind to the transforming growth factor beta type II receptor to promote the epithelial-mesenchymal transition and tumor angiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted allele encoding a truncated protein exhibit normal morphology. Mice with a point mutation show skeletal abnormalities, bone metabolism alterations, changes in renal function, behavioral alternations and hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Scube3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Scube3 APN 17 28167684 missense probably damaging 1.00
IGL02189:Scube3 APN 17 28162996 missense probably benign
IGL02416:Scube3 APN 17 28164136 missense probably damaging 1.00
IGL02904:Scube3 APN 17 28167600 missense probably benign 0.01
IGL03153:Scube3 APN 17 28167058 missense possibly damaging 0.54
IGL03309:Scube3 APN 17 28164357 nonsense probably null
dinklage UTSW 17 28162388 missense probably damaging 1.00
R0027:Scube3 UTSW 17 28164357 nonsense probably null
R0122:Scube3 UTSW 17 28166528 splice site probably benign
R0544:Scube3 UTSW 17 28164153 missense probably damaging 1.00
R1779:Scube3 UTSW 17 28168379 splice site probably benign
R1842:Scube3 UTSW 17 28165089 missense probably damaging 1.00
R1878:Scube3 UTSW 17 28152413 missense probably benign 0.10
R1950:Scube3 UTSW 17 28164300 missense possibly damaging 0.66
R2011:Scube3 UTSW 17 28168158 missense probably damaging 0.99
R2164:Scube3 UTSW 17 28166134 missense possibly damaging 0.64
R4356:Scube3 UTSW 17 28164309 missense probably benign 0.01
R4392:Scube3 UTSW 17 28164788 missense probably null
R4528:Scube3 UTSW 17 28162999 missense possibly damaging 0.82
R4709:Scube3 UTSW 17 28167192 splice site probably null
R4809:Scube3 UTSW 17 28165173 missense probably damaging 1.00
R4832:Scube3 UTSW 17 28166015 missense probably damaging 0.98
R4841:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R4842:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R5372:Scube3 UTSW 17 28152482 missense probably damaging 0.99
R5889:Scube3 UTSW 17 28160913 missense possibly damaging 0.84
R5936:Scube3 UTSW 17 28165487 missense probably damaging 1.00
R6523:Scube3 UTSW 17 28162388 missense probably damaging 1.00
R7051:Scube3 UTSW 17 28167599 missense probably benign
R7337:Scube3 UTSW 17 28168182 missense probably damaging 1.00
R7699:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7700:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7848:Scube3 UTSW 17 28165595 missense probably benign
R7931:Scube3 UTSW 17 28165595 missense probably benign
RF009:Scube3 UTSW 17 28168397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGAGCAAGCTTTCACCACAATC -3'
(R):5'- ACAGCCATTTGGAGTGTGAAGAGTC -3'

Sequencing Primer
(F):5'- gaaggcagagacaggcag -3'
(R):5'- TGTGAAGAGTCGAGGGCTG -3'
Posted On2013-04-11