Incidental Mutation 'R1794:Cdcp1'
ID202059
Institutional Source Beutler Lab
Gene Symbol Cdcp1
Ensembl Gene ENSMUSG00000035498
Gene NameCUB domain containing protein 1
Synonyms
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1794 (G1)
Quality Score174
Status Not validated
Chromosome9
Chromosomal Location123170824-123216038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123215831 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 27 (T27A)
Ref Sequence ENSEMBL: ENSMUSP00000042057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039229]
Predicted Effect probably benign
Transcript: ENSMUST00000039229
AA Change: T27A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042057
Gene: ENSMUSG00000035498
AA Change: T27A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 56 267 1.33e-11 PROSPERO
internal_repeat_1 374 591 1.33e-11 PROSPERO
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140915
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which contains three extracellular CUB domains and acts as a substrate for Src family kinases. The protein plays a role in the tyrosine phosphorylation-dependent regulation of cellular events that are involved in tumor invasion and metastasis. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Cdcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cdcp1 APN 9 123180001 nonsense probably null
IGL01883:Cdcp1 APN 9 123183598 missense probably benign 0.18
IGL02029:Cdcp1 APN 9 123183834 splice site probably benign
IGL02115:Cdcp1 APN 9 123185397 missense probably damaging 1.00
IGL02516:Cdcp1 APN 9 123173637 missense possibly damaging 0.86
IGL02709:Cdcp1 APN 9 123173814 missense probably damaging 1.00
IGL03263:Cdcp1 APN 9 123180087 missense probably benign 0.12
IGL03406:Cdcp1 APN 9 123185313 missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123180172 missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123180172 missense probably benign 0.00
R0939:Cdcp1 UTSW 9 123183690 missense probably damaging 1.00
R1411:Cdcp1 UTSW 9 123190112 missense probably damaging 0.99
R1460:Cdcp1 UTSW 9 123180027 missense possibly damaging 0.69
R1538:Cdcp1 UTSW 9 123173588 missense probably damaging 1.00
R1660:Cdcp1 UTSW 9 123185362 missense probably benign 0.09
R1673:Cdcp1 UTSW 9 123178021 nonsense probably null
R1794:Cdcp1 UTSW 9 123190094 missense probably benign 0.37
R2472:Cdcp1 UTSW 9 123185107 missense probably benign 0.07
R3961:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R3962:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R4288:Cdcp1 UTSW 9 123183628 missense probably damaging 0.99
R4888:Cdcp1 UTSW 9 123182129 intron probably benign
R4953:Cdcp1 UTSW 9 123180023 missense probably benign 0.00
R5236:Cdcp1 UTSW 9 123185193 missense probably damaging 1.00
R5546:Cdcp1 UTSW 9 123178029 missense probably damaging 1.00
R5848:Cdcp1 UTSW 9 123183705 missense possibly damaging 0.87
R5903:Cdcp1 UTSW 9 123173772 nonsense probably null
R6052:Cdcp1 UTSW 9 123185331 missense probably benign 0.04
R6344:Cdcp1 UTSW 9 123182382 missense possibly damaging 0.69
R6904:Cdcp1 UTSW 9 123173915 missense probably benign
R7038:Cdcp1 UTSW 9 123173597 missense probably damaging 1.00
R7092:Cdcp1 UTSW 9 123183613 missense probably benign 0.20
R7262:Cdcp1 UTSW 9 123173615 missense probably damaging 1.00
R7275:Cdcp1 UTSW 9 123185054 missense possibly damaging 0.79
R7294:Cdcp1 UTSW 9 123177921 missense probably benign 0.01
R7373:Cdcp1 UTSW 9 123177900 missense probably damaging 1.00
R7394:Cdcp1 UTSW 9 123173813 missense probably damaging 1.00
R7527:Cdcp1 UTSW 9 123185107 missense probably benign 0.26
R7680:Cdcp1 UTSW 9 123183519 missense probably damaging 1.00
X0028:Cdcp1 UTSW 9 123185184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTATTTGTTCCTAGGCCAGGG -3'
(R):5'- AGGGTAGTACCTGAGCTGAG -3'

Sequencing Primer
(F):5'- TTCCTAGGCCAGGGAAGCTC -3'
(R):5'- AGGAAGCGTGGGTCACC -3'
Posted On2014-06-23