Incidental Mutation 'R1796:Vmn2r70'
ID202260
Institutional Source Beutler Lab
Gene Symbol Vmn2r70
Ensembl Gene ENSMUSG00000090806
Gene Namevomeronasal 2, receptor 70
SynonymsEG620835
MMRRC Submission 039826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1796 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85558703-85569088 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 85563803 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 465 (Y465*)
Ref Sequence ENSEMBL: ENSMUSP00000129703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168230]
Predicted Effect probably null
Transcript: ENSMUST00000168230
AA Change: Y465*
SMART Domains Protein: ENSMUSP00000129703
Gene: ENSMUSG00000090806
AA Change: Y465*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.5e-28 PFAM
Pfam:NCD3G 510 562 1.5e-19 PFAM
Pfam:7tm_3 592 830 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,155,372 P1808S probably damaging Het
Abcd4 G A 12: 84,615,382 S30F probably benign Het
Abtb1 T C 6: 88,836,619 D379G possibly damaging Het
Adgre1 A G 17: 57,441,350 I517V probably benign Het
AF366264 A T 8: 13,836,816 L425* probably null Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt4 G A 2: 151,938,989 V386M probably damaging Het
Asic1 A G 15: 99,696,654 H360R probably null Het
Asxl1 G A 2: 153,401,606 A1359T probably benign Het
Atp8a2 C T 14: 60,020,758 probably null Het
BC003331 T C 1: 150,375,554 N283S probably benign Het
C1qtnf2 T A 11: 43,491,287 F279I probably damaging Het
Car8 A T 4: 8,221,671 L100* probably null Het
Cd52 T C 4: 134,094,984 M1V probably null Het
Celf5 T C 10: 81,467,219 I163V possibly damaging Het
Cep250 A T 2: 155,992,187 T2010S possibly damaging Het
Cfap65 C T 1: 74,918,948 V934M probably damaging Het
Colec11 A T 12: 28,594,859 I212N probably damaging Het
Cpa3 C T 3: 20,223,227 probably null Het
Ctnnd1 G T 2: 84,615,209 H495N probably damaging Het
Cyb5a T C 18: 84,851,561 V28A probably benign Het
Ddo A T 10: 40,647,629 Q205L probably benign Het
Dnah1 T A 14: 31,261,093 N4195I probably benign Het
E2f1 A T 2: 154,560,929 V306E probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Eef1d A C 15: 75,901,175 F25C probably damaging Het
Ehd3 A T 17: 73,830,359 I508F probably damaging Het
Eml6 T A 11: 29,881,975 I232F probably benign Het
Enc1 T A 13: 97,246,483 D500E probably benign Het
Enc1 C A 13: 97,246,485 T501K possibly damaging Het
Fam126a T G 5: 23,986,151 T173P probably damaging Het
Fam83f C T 15: 80,690,082 R213W possibly damaging Het
Fbxo31 A T 8: 121,560,438 L158* probably null Het
Foxi3 C A 6: 70,960,810 T342N possibly damaging Het
Gm996 C T 2: 25,577,988 G637D probably damaging Het
Gpr179 T A 11: 97,336,556 D1591V possibly damaging Het
Gpsm2 A G 3: 108,701,850 V151A probably damaging Het
Grk2 T G 19: 4,287,940 I513L probably benign Het
H2-Ab1 A G 17: 34,267,372 E135G probably damaging Het
Herc1 A T 9: 66,388,856 K578* probably null Het
Itpr2 T C 6: 146,296,673 N1533S probably benign Het
Kif3c A G 12: 3,367,299 N440S probably benign Het
Klhdc2 T C 12: 69,300,297 probably null Het
Kmo G T 1: 175,637,895 V72L probably benign Het
Krt71 A G 15: 101,742,880 I56T possibly damaging Het
Krt72 T C 15: 101,781,552 probably null Het
Krt78 T A 15: 101,950,865 Q299L probably damaging Het
Loxhd1 G A 18: 77,425,639 E1774K possibly damaging Het
Loxhd1 C T 18: 77,405,907 R1521C probably damaging Het
Ly6g6f T C 17: 35,083,502 S20G probably benign Het
Mecr T A 4: 131,865,071 M282K probably damaging Het
Mfsd14a G T 3: 116,634,947 A353D probably damaging Het
Mroh9 A T 1: 163,045,710 N564K probably damaging Het
Mrs2 T A 13: 24,997,128 T237S possibly damaging Het
Mycbpap A G 11: 94,507,551 L534S probably damaging Het
Myh1 T C 11: 67,224,357 I1906T probably benign Het
Myh4 T A 11: 67,260,324 V1935D probably benign Het
Myo18a T C 11: 77,829,344 I684T possibly damaging Het
Myo7b C T 18: 31,986,675 R788H possibly damaging Het
Nbea A T 3: 55,643,708 D2678E possibly damaging Het
Ndufs3 A C 2: 90,898,706 Y145* probably null Het
Nrros A G 16: 32,143,511 F563L probably damaging Het
Ntn4 T C 10: 93,745,771 V602A probably damaging Het
Obscn C A 11: 59,029,337 R6736L possibly damaging Het
Olfr159 T A 4: 43,770,495 D172V possibly damaging Het
Olfr26 T A 9: 38,855,524 V154D probably benign Het
Olfr698 T C 7: 106,752,549 I280V probably benign Het
Olfr837 C A 9: 19,137,917 T308K probably benign Het
Olfr969 C T 9: 39,796,005 P210L possibly damaging Het
Olfr972 A G 9: 39,873,971 E232G probably benign Het
Pik3cd A G 4: 149,654,119 F751L possibly damaging Het
Plekhh2 A G 17: 84,599,133 probably null Het
Postn A G 3: 54,373,756 H434R probably damaging Het
Prss39 A G 1: 34,500,033 D118G possibly damaging Het
Ralyl G T 3: 14,143,433 G211V possibly damaging Het
Rbak T A 5: 143,173,447 E617V probably damaging Het
Rbms3 A T 9: 116,719,333 W80R probably damaging Het
Retnlg A T 16: 48,874,247 Y86F probably benign Het
Rtel1 T A 2: 181,352,103 S643T probably benign Het
Serpina11 A T 12: 103,984,695 F256I probably damaging Het
Setd2 A T 9: 110,617,816 probably null Het
Setd2 A T 9: 110,550,345 Y1076F probably benign Het
Sgsm1 T C 5: 113,273,617 T248A possibly damaging Het
Slc6a21 T C 7: 45,280,755 Y193H probably damaging Het
Slfn9 T C 11: 82,981,955 K652E probably benign Het
Stt3b A T 9: 115,248,607 Y692* probably null Het
Sval3 A G 6: 41,968,162 Q8R probably benign Het
Synm T A 7: 67,734,000 I1305F possibly damaging Het
Tdrd1 T C 19: 56,837,783 F169L probably damaging Het
Tecta T A 9: 42,384,197 D334V probably damaging Het
Tle2 G A 10: 81,589,497 probably null Het
Tmem243 A G 5: 9,116,489 I30V probably benign Het
Treml2 T C 17: 48,309,502 *330R probably null Het
Trpm6 A G 19: 18,827,567 D961G possibly damaging Het
Ubr4 T C 4: 139,428,596 V2244A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc79 G T 12: 103,142,746 V2148F probably damaging Het
Ush2a A C 1: 188,910,827 T4129P probably benign Het
Vgll2 G A 10: 52,025,228 V85I probably damaging Het
Vmn1r16 T C 6: 57,323,271 Y122C probably benign Het
Vmn1r22 A T 6: 57,900,149 I91N probably damaging Het
Wdr64 A T 1: 175,717,331 E110V probably damaging Het
Wfdc6a A T 2: 164,580,311 C123S probably damaging Het
Xrcc1 A G 7: 24,547,827 Y30C probably damaging Het
Zdhhc7 T C 8: 120,085,418 K155R probably benign Het
Zfp560 A G 9: 20,351,930 F50S possibly damaging Het
Zfp616 C T 11: 74,085,845 T980I probably damaging Het
Zfp808 C T 13: 62,171,856 P300S probably damaging Het
Zfp979 G A 4: 147,613,283 T323I probably damaging Het
Other mutations in Vmn2r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Vmn2r70 APN 7 85563799 missense probably benign 0.00
IGL01140:Vmn2r70 APN 7 85565171 nonsense probably null
IGL01287:Vmn2r70 APN 7 85569019 nonsense probably null
IGL01581:Vmn2r70 APN 7 85563914 splice site probably null
IGL01632:Vmn2r70 APN 7 85566072 missense probably benign 0.00
IGL01725:Vmn2r70 APN 7 85559386 missense probably damaging 1.00
IGL02244:Vmn2r70 APN 7 85565003 missense probably benign
IGL02288:Vmn2r70 APN 7 85565134 missense probably benign 0.31
IGL02313:Vmn2r70 APN 7 85565168 missense probably damaging 0.99
IGL02591:Vmn2r70 APN 7 85564945 missense probably damaging 0.96
IGL02725:Vmn2r70 APN 7 85565345 missense possibly damaging 0.46
IGL02797:Vmn2r70 APN 7 85559087 missense probably benign 0.00
R0045:Vmn2r70 UTSW 7 85566044 missense probably damaging 1.00
R0729:Vmn2r70 UTSW 7 85565904 missense probably benign 0.00
R0967:Vmn2r70 UTSW 7 85559619 missense probably damaging 0.99
R1217:Vmn2r70 UTSW 7 85559061 missense probably damaging 1.00
R1351:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R1387:Vmn2r70 UTSW 7 85558761 missense probably benign 0.12
R1483:Vmn2r70 UTSW 7 85559167 missense probably benign 0.04
R1809:Vmn2r70 UTSW 7 85565922 missense probably benign 0.23
R2154:Vmn2r70 UTSW 7 85563715 missense possibly damaging 0.67
R2173:Vmn2r70 UTSW 7 85565082 missense probably benign
R2334:Vmn2r70 UTSW 7 85559592 missense probably benign 0.05
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R3975:Vmn2r70 UTSW 7 85559332 missense probably benign 0.00
R4525:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4527:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4535:Vmn2r70 UTSW 7 85565333 missense probably damaging 1.00
R5181:Vmn2r70 UTSW 7 85559179 missense probably damaging 0.99
R5600:Vmn2r70 UTSW 7 85563727 missense probably benign 0.07
R5641:Vmn2r70 UTSW 7 85559364 missense probably damaging 0.99
R5726:Vmn2r70 UTSW 7 85559107 missense probably damaging 1.00
R5943:Vmn2r70 UTSW 7 85565991 missense probably benign 0.09
R6166:Vmn2r70 UTSW 7 85565981 missense probably benign 0.25
R6272:Vmn2r70 UTSW 7 85558986 missense probably damaging 1.00
R6324:Vmn2r70 UTSW 7 85558879 missense probably benign 0.01
R6429:Vmn2r70 UTSW 7 85559068 missense probably damaging 1.00
R6449:Vmn2r70 UTSW 7 85564949 missense probably damaging 1.00
R6512:Vmn2r70 UTSW 7 85566097 missense probably benign
R7000:Vmn2r70 UTSW 7 85559611 missense probably damaging 0.99
R7141:Vmn2r70 UTSW 7 85558836 missense probably benign
R7153:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R7424:Vmn2r70 UTSW 7 85563868 missense probably damaging 1.00
R7565:Vmn2r70 UTSW 7 85565291 missense probably benign 0.35
R7567:Vmn2r70 UTSW 7 85565035 missense probably benign 0.41
R7593:Vmn2r70 UTSW 7 85566104 nonsense probably null
R7660:Vmn2r70 UTSW 7 85568922 missense probably damaging 0.99
R7806:Vmn2r70 UTSW 7 85559193 missense probably benign
R7892:Vmn2r70 UTSW 7 85559380 missense possibly damaging 0.58
R7965:Vmn2r70 UTSW 7 85561863 missense probably damaging 0.96
R8052:Vmn2r70 UTSW 7 85563715 missense probably benign
R8251:Vmn2r70 UTSW 7 85565978 nonsense probably null
Z1088:Vmn2r70 UTSW 7 85564760 missense possibly damaging 0.53
Z1176:Vmn2r70 UTSW 7 85569045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCGGGCAGTGTAAAGTAATTC -3'
(R):5'- TTGAATACTTCTGGCAAGGTTAGG -3'

Sequencing Primer
(F):5'- GGCAGTGTAAAGTAATTCAATAAAGG -3'
(R):5'- AATACTTCTGGCAAGGTTAGGTTTTG -3'
Posted On2014-06-23