Incidental Mutation 'R7806:Vmn2r70'
ID600773
Institutional Source Beutler Lab
Gene Symbol Vmn2r70
Ensembl Gene ENSMUSG00000090806
Gene Namevomeronasal 2, receptor 70
SynonymsEG620835
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7806 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85558703-85569088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85559193 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 692 (I692K)
Ref Sequence ENSEMBL: ENSMUSP00000129703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168230]
Predicted Effect probably benign
Transcript: ENSMUST00000168230
AA Change: I692K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129703
Gene: ENSMUSG00000090806
AA Change: I692K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.5e-28 PFAM
Pfam:NCD3G 510 562 1.5e-19 PFAM
Pfam:7tm_3 592 830 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (83/85)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,842,404 V144F probably benign Het
Aar2 T A 2: 156,551,111 I140N possibly damaging Het
Abca15 A G 7: 120,332,836 N104S probably damaging Het
Adam22 A T 5: 8,092,825 N803K probably damaging Het
Adk A G 14: 21,326,611 N26S Het
Ak9 A C 10: 41,433,084 probably null Het
Alpk2 T C 18: 65,349,416 D40G probably benign Het
Ankrd65 A T 4: 155,792,980 H316L probably benign Het
Cabp7 C T 11: 4,738,889 A194T probably damaging Het
Ccdc180 A C 4: 45,912,801 K593N possibly damaging Het
Cd80 A G 16: 38,473,953 D66G probably benign Het
Cdh5 T C 8: 104,140,816 V575A probably damaging Het
Cep350 T C 1: 155,862,063 Q2678R probably benign Het
Cideb G A 14: 55,755,168 T97M probably damaging Het
Clca4b T C 3: 144,932,396 D35G probably benign Het
Clpx T C 9: 65,299,931 V37A probably benign Het
Cmya5 A C 13: 93,094,262 S1439R probably benign Het
Cndp2 T A 18: 84,670,820 H279L probably benign Het
Cngb1 A T 8: 95,298,804 probably null Het
Cpq T A 15: 33,497,297 N394K possibly damaging Het
Dedd T C 1: 171,338,494 L60P probably benign Het
Dennd3 C A 15: 73,570,775 L1216M possibly damaging Het
Dntt A T 19: 41,029,632 N65I probably benign Het
Fap T A 2: 62,503,414 E662V probably damaging Het
Fasn A T 11: 120,809,995 M2066K probably benign Het
Fggy G A 4: 95,600,966 G69E probably benign Het
Foxc1 G T 13: 31,808,756 G517C unknown Het
Gas2l3 A G 10: 89,413,370 Y629H probably benign Het
Gcnt2 A G 13: 40,918,241 N120S probably damaging Het
Gfpt2 A G 11: 49,823,315 T300A probably benign Het
Glud1 A G 14: 34,343,649 R535G probably damaging Het
Gm3248 T A 14: 5,943,883 I114L probably benign Het
Gm3278 G A 14: 4,895,172 probably null Het
Gm3402 A C 5: 146,514,280 K44Q probably damaging Het
Gm3696 C G 14: 7,087,893 R188S probably benign Het
Gm3696 C A 14: 7,087,894 R188M probably benign Het
Gmppa T C 1: 75,438,937 L113P probably damaging Het
Gmps A G 3: 63,982,670 probably null Het
Gnal T A 18: 67,213,074 M275K probably damaging Het
Gopc G C 10: 52,353,429 N231K probably damaging Het
Gpr152 T C 19: 4,143,488 S343P probably benign Het
Gpr17 T C 18: 31,947,540 I157V probably benign Het
Grm7 T A 6: 111,246,353 Y451* probably null Het
Ikbke T C 1: 131,271,898 E286G probably damaging Het
Inpp5b A T 4: 124,785,088 probably null Het
Iqgap2 G A 13: 95,682,257 L664F probably benign Het
Kif17 A G 4: 138,288,196 E552G possibly damaging Het
Lamtor1 T A 7: 101,906,013 Y5* probably null Het
Lpin2 A G 17: 71,245,171 I829V probably damaging Het
Lrg1 T G 17: 56,119,967 D335A probably benign Het
Lrriq3 T C 3: 155,098,807 Y35H probably damaging Het
Mkx T A 18: 7,000,607 M112L probably benign Het
Mlxipl A C 5: 135,134,543 D760A possibly damaging Het
Muc6 T C 7: 141,637,474 T2429A possibly damaging Het
N4bp2l2 A G 5: 150,643,250 C134R unknown Het
Nanos1 A G 19: 60,756,534 E90G probably benign Het
Nckap1 T C 2: 80,541,499 D329G probably damaging Het
Olfr112 A C 17: 37,564,221 L30R probably damaging Het
Olfr46 T C 7: 140,610,772 I194T probably benign Het
Olfr876 T C 9: 37,804,576 S222P probably damaging Het
Olfr919 G T 9: 38,698,271 L32I probably benign Het
Osbpl7 A G 11: 97,056,128 H419R probably benign Het
Otog C T 7: 46,285,776 T1395I probably benign Het
Pigq T A 17: 25,931,726 I451F probably benign Het
Ptgfrn A G 3: 101,077,132 V248A possibly damaging Het
Rdh19 G T 10: 127,856,871 V136L probably damaging Het
Rfesd T C 13: 76,008,189 T33A possibly damaging Het
Rnf213 G A 11: 119,411,545 V432M Het
Rpl22l1 T A 3: 28,806,813 L60Q probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Samd3 A G 10: 26,244,527 T140A probably benign Het
Sbf1 A G 15: 89,305,420 V419A possibly damaging Het
Serpinb6a T C 13: 33,935,565 probably null Het
Slc22a4 A G 11: 53,990,650 L414P probably damaging Het
Smarcd3 A T 5: 24,593,262 V420D probably benign Het
Tcaim A G 9: 122,834,930 D495G probably damaging Het
Tcrg-C2 A T 13: 19,307,220 probably benign Het
Tep1 A G 14: 50,836,809 V1873A possibly damaging Het
Tmcc2 T C 1: 132,360,789 N387D probably damaging Het
Tmed8 A T 12: 87,172,430 I322N probably damaging Het
Tmod4 A C 3: 95,127,604 D168A probably benign Het
Trp53bp1 C T 2: 121,205,061 E1520K probably damaging Het
Trpv5 T A 6: 41,674,933 I183F probably damaging Het
Vmn2r87 T A 10: 130,479,810 Y129F probably benign Het
Vps8 A G 16: 21,459,751 D253G probably damaging Het
Ythdc2 T C 18: 44,844,286 I383T possibly damaging Het
Ythdc2 T C 18: 44,850,424 S553P probably benign Het
Zfyve26 A G 12: 79,280,355 probably null Het
Zic1 G A 9: 91,364,971 T16I probably damaging Het
Other mutations in Vmn2r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Vmn2r70 APN 7 85563799 missense probably benign 0.00
IGL01140:Vmn2r70 APN 7 85565171 nonsense probably null
IGL01287:Vmn2r70 APN 7 85569019 nonsense probably null
IGL01581:Vmn2r70 APN 7 85563914 splice site probably null
IGL01632:Vmn2r70 APN 7 85566072 missense probably benign 0.00
IGL01725:Vmn2r70 APN 7 85559386 missense probably damaging 1.00
IGL02244:Vmn2r70 APN 7 85565003 missense probably benign
IGL02288:Vmn2r70 APN 7 85565134 missense probably benign 0.31
IGL02313:Vmn2r70 APN 7 85565168 missense probably damaging 0.99
IGL02591:Vmn2r70 APN 7 85564945 missense probably damaging 0.96
IGL02725:Vmn2r70 APN 7 85565345 missense possibly damaging 0.46
IGL02797:Vmn2r70 APN 7 85559087 missense probably benign 0.00
R0045:Vmn2r70 UTSW 7 85566044 missense probably damaging 1.00
R0729:Vmn2r70 UTSW 7 85565904 missense probably benign 0.00
R0967:Vmn2r70 UTSW 7 85559619 missense probably damaging 0.99
R1217:Vmn2r70 UTSW 7 85559061 missense probably damaging 1.00
R1351:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R1387:Vmn2r70 UTSW 7 85558761 missense probably benign 0.12
R1483:Vmn2r70 UTSW 7 85559167 missense probably benign 0.04
R1796:Vmn2r70 UTSW 7 85563803 nonsense probably null
R1809:Vmn2r70 UTSW 7 85565922 missense probably benign 0.23
R2154:Vmn2r70 UTSW 7 85563715 missense possibly damaging 0.67
R2173:Vmn2r70 UTSW 7 85565082 missense probably benign
R2334:Vmn2r70 UTSW 7 85559592 missense probably benign 0.05
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R3975:Vmn2r70 UTSW 7 85559332 missense probably benign 0.00
R4525:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4527:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4535:Vmn2r70 UTSW 7 85565333 missense probably damaging 1.00
R5181:Vmn2r70 UTSW 7 85559179 missense probably damaging 0.99
R5600:Vmn2r70 UTSW 7 85563727 missense probably benign 0.07
R5641:Vmn2r70 UTSW 7 85559364 missense probably damaging 0.99
R5726:Vmn2r70 UTSW 7 85559107 missense probably damaging 1.00
R5943:Vmn2r70 UTSW 7 85565991 missense probably benign 0.09
R6166:Vmn2r70 UTSW 7 85565981 missense probably benign 0.25
R6272:Vmn2r70 UTSW 7 85558986 missense probably damaging 1.00
R6324:Vmn2r70 UTSW 7 85558879 missense probably benign 0.01
R6429:Vmn2r70 UTSW 7 85559068 missense probably damaging 1.00
R6449:Vmn2r70 UTSW 7 85564949 missense probably damaging 1.00
R6512:Vmn2r70 UTSW 7 85566097 missense probably benign
R7000:Vmn2r70 UTSW 7 85559611 missense probably damaging 0.99
R7141:Vmn2r70 UTSW 7 85558836 missense probably benign
R7153:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R7424:Vmn2r70 UTSW 7 85563868 missense probably damaging 1.00
R7565:Vmn2r70 UTSW 7 85565291 missense probably benign 0.35
R7567:Vmn2r70 UTSW 7 85565035 missense probably benign 0.41
R7593:Vmn2r70 UTSW 7 85566104 nonsense probably null
R7660:Vmn2r70 UTSW 7 85568922 missense probably damaging 0.99
R7892:Vmn2r70 UTSW 7 85559380 missense possibly damaging 0.58
R7965:Vmn2r70 UTSW 7 85561863 missense probably damaging 0.96
R8052:Vmn2r70 UTSW 7 85563715 missense probably benign
R8251:Vmn2r70 UTSW 7 85565978 nonsense probably null
Z1088:Vmn2r70 UTSW 7 85564760 missense possibly damaging 0.53
Z1176:Vmn2r70 UTSW 7 85569045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCCCATGTATCCAAGG -3'
(R):5'- AACAACCAATCTCTCAGCTTTGTC -3'

Sequencing Primer
(F):5'- TGTATCCAAGGACACAGTAGAATGC -3'
(R):5'- AATCTCTCAGCTTTGTCCTACTCATC -3'
Posted On2019-11-26