Incidental Mutation 'R6111:Mios'
ID 484836
Institutional Source Beutler Lab
Gene Symbol Mios
Ensembl Gene ENSMUSG00000042447
Gene Name meiosis regulator for oocyte development
Synonyms
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock # R6111 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 8209222-8236274 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 8214836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 11 (A11T)
Ref Sequence ENSEMBL: ENSMUSP00000039301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040017]
AlphaFold Q8VE19
Predicted Effect probably benign
Transcript: ENSMUST00000040017
AA Change: A11T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000039301
Gene: ENSMUSG00000042447
AA Change: A11T

DomainStartEndE-ValueType
Blast:WD40 49 91 2e-18 BLAST
WD40 101 146 2.05e1 SMART
WD40 174 212 3.55e1 SMART
WD40 214 252 2.45e2 SMART
WD40 256 297 6.42e-1 SMART
Blast:WD40 312 354 2e-13 BLAST
Pfam:zinc_ribbon_16 737 861 1.3e-26 PFAM
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Mios
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mios APN 6 8234363 critical splice donor site probably null
IGL01365:Mios APN 6 8216089 nonsense probably null
IGL01548:Mios APN 6 8234252 missense possibly damaging 0.90
IGL01898:Mios APN 6 8222668 missense probably benign 0.03
IGL02110:Mios APN 6 8215565 missense probably damaging 1.00
IGL02308:Mios APN 6 8231269 missense probably benign 0.06
IGL02375:Mios APN 6 8222598 missense probably benign 0.02
IGL02452:Mios APN 6 8222492 missense probably benign 0.01
IGL02670:Mios APN 6 8235378 splice site probably benign
IGL03083:Mios APN 6 8215156 missense probably damaging 1.00
R0462:Mios UTSW 6 8215743 missense probably benign 0.11
R0591:Mios UTSW 6 8215470 missense possibly damaging 0.52
R1351:Mios UTSW 6 8228120 missense possibly damaging 0.70
R1476:Mios UTSW 6 8234237 missense probably benign 0.01
R1802:Mios UTSW 6 8216385 nonsense probably null
R1959:Mios UTSW 6 8215437 missense probably benign 0.17
R1964:Mios UTSW 6 8215798 missense probably damaging 0.99
R2272:Mios UTSW 6 8226865 missense possibly damaging 0.71
R2915:Mios UTSW 6 8214935 missense possibly damaging 0.72
R3852:Mios UTSW 6 8216453 missense probably benign 0.09
R3876:Mios UTSW 6 8233189 missense probably damaging 0.98
R3948:Mios UTSW 6 8215496 missense probably benign
R4698:Mios UTSW 6 8228113 missense possibly damaging 0.60
R4785:Mios UTSW 6 8222464 missense probably benign
R4789:Mios UTSW 6 8235429 missense probably benign 0.06
R4866:Mios UTSW 6 8214857 missense probably damaging 1.00
R4878:Mios UTSW 6 8215094 missense probably benign 0.00
R4991:Mios UTSW 6 8215847 missense probably benign 0.00
R5479:Mios UTSW 6 8215314 missense probably benign 0.00
R5714:Mios UTSW 6 8215434 missense probably damaging 0.99
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6455:Mios UTSW 6 8231239 missense probably benign 0.03
R7381:Mios UTSW 6 8216064 missense probably damaging 0.98
R8350:Mios UTSW 6 8227998 missense probably benign 0.00
R8708:Mios UTSW 6 8234255 missense probably benign 0.17
R8913:Mios UTSW 6 8215924 missense probably benign
R9062:Mios UTSW 6 8233221 missense probably benign 0.00
R9359:Mios UTSW 6 8214894 missense probably benign 0.17
R9521:Mios UTSW 6 8233171 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TCTTGAAACTGTAGGGTGAGAG -3'
(R):5'- CCAACTGCTAGGAGACATTCAG -3'

Sequencing Primer
(F):5'- CTGTAGGGTGAGAGAAAAATACAATC -3'
(R):5'- GGATCATAATTGAGATACCACGC -3'
Posted On 2017-08-16