Incidental Mutation 'R1906:Arhgap27'
ID214395
Institutional Source Beutler Lab
Gene Symbol Arhgap27
Ensembl Gene ENSMUSG00000034255
Gene NameRho GTPase activating protein 27
Synonyms5730442P18Rik, Sh3d20, 2310069I04Rik
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1906 (G1)
Quality Score165
Status Not validated
Chromosome11
Chromosomal Location103331497-103363692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103332925 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 651 (F651L)
Ref Sequence ENSEMBL: ENSMUSP00000039427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041385] [ENSMUST00000107024]
Predicted Effect probably damaging
Transcript: ENSMUST00000041385
AA Change: F651L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039427
Gene: ENSMUSG00000034255
AA Change: F651L

DomainStartEndE-ValueType
WW 48 81 3.49e-8 SMART
WW 101 134 7.44e-3 SMART
WW 216 248 2.32e-4 SMART
PH 279 396 1.08e-9 SMART
Blast:RhoGAP 446 480 2e-10 BLAST
RhoGAP 489 664 1.45e-68 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107024
AA Change: F850L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102639
Gene: ENSMUSG00000034255
AA Change: F850L

DomainStartEndE-ValueType
SH3 9 68 1.59e-1 SMART
low complexity region 73 89 N/A INTRINSIC
WW 247 280 3.49e-8 SMART
WW 300 333 7.44e-3 SMART
WW 415 447 2.32e-4 SMART
PH 478 595 1.08e-9 SMART
Blast:RhoGAP 651 682 1e-6 BLAST
RhoGAP 688 863 1.45e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163250
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may pay a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Arhgap27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Arhgap27 APN 11 103333163 missense probably benign 0.00
IGL02946:Arhgap27 APN 11 103338348 missense probably damaging 1.00
IGL03135:Arhgap27 APN 11 103339065 splice site probably null
R1789:Arhgap27 UTSW 11 103333005 missense probably damaging 1.00
R1842:Arhgap27 UTSW 11 103339996 missense probably damaging 0.99
R2884:Arhgap27 UTSW 11 103360843 splice site probably null
R2885:Arhgap27 UTSW 11 103360843 splice site probably null
R3157:Arhgap27 UTSW 11 103333837 splice site probably null
R4679:Arhgap27 UTSW 11 103360949 unclassified probably benign
R4708:Arhgap27 UTSW 11 103333562 splice site probably benign
R4926:Arhgap27 UTSW 11 103339123 splice site probably null
R5980:Arhgap27 UTSW 11 103356269 missense probably benign 0.00
R6212:Arhgap27 UTSW 11 103360872 missense probably damaging 1.00
R7205:Arhgap27 UTSW 11 103344541 missense probably benign 0.00
R7208:Arhgap27 UTSW 11 103360759 missense probably damaging 1.00
R7212:Arhgap27 UTSW 11 103360755 missense probably damaging 0.99
R7327:Arhgap27 UTSW 11 103360541 nonsense probably null
R7598:Arhgap27 UTSW 11 103334053 nonsense probably null
R7732:Arhgap27 UTSW 11 103340043 missense probably benign 0.00
R7791:Arhgap27 UTSW 11 103339194 critical splice donor site probably null
R7826:Arhgap27 UTSW 11 103338327 missense probably benign
R7869:Arhgap27 UTSW 11 103360304 missense probably damaging 0.96
R7949:Arhgap27 UTSW 11 103337769 missense probably damaging 0.98
R8057:Arhgap27 UTSW 11 103338693 missense probably damaging 1.00
R8397:Arhgap27 UTSW 11 103333247 missense probably damaging 0.98
X0028:Arhgap27 UTSW 11 103333028 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTTCATGAACTGCCCACCAGG -3'
(R):5'- CCGTATTTCCTGGGGCAAAAG -3'

Sequencing Primer
(F):5'- GGGTCACTGTACCCTCTGAATG -3'
(R):5'- TATTTCCTGGGGCAAAAGAGGAG -3'
Posted On2014-07-14