Incidental Mutation 'R1906:Foxn1'
ID 214393
Institutional Source Beutler Lab
Gene Symbol Foxn1
Ensembl Gene ENSMUSG00000002057
Gene Name forkhead box N1
Synonyms whn, D11Bhm185e, Hfh11
MMRRC Submission 039925-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1906 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 78357577-78386558 bp(-) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to G at 78371810 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108294]
AlphaFold Q61575
Predicted Effect probably null
Transcript: ENSMUST00000108294
SMART Domains Protein: ENSMUSP00000103929
Gene: ENSMUSG00000002057

DomainStartEndE-ValueType
FH 269 361 2.43e-45 SMART
low complexity region 392 409 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 558 586 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the forkhead family or "winged-helix" transcription factors that are important in developmental processes, immune system regulation, metabolism, cancer and aging. This gene family has over 100 members, subdivided into classes (A-Q) based on phylogeny. The encoded protein is proposed to regulate development of the thymus and differentiation of keratinocytes. Mutations in this gene cause severe primary T-cell immunodeficiency and congenital alopecia. In mouse mutations of this gene underlie the phenotype of the nude mouse, which has been widely used as a model system in oncology, immunology, dermatology, and transplantation studies. In humans mutations in this gene have been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for different mutations have in genetically determined absence or loss of hair and failed hair keratinization, premature lethality (differing by genetic background) and absence of thymus, resulting in multiple immune abnormalities. Heterozygotes have enlarged thymuses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Sptbn4 A G 7: 27,391,431 probably null Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Foxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Foxn1 APN 11 78371283 missense probably benign 0.24
IGL01391:Foxn1 APN 11 78361494 missense probably damaging 1.00
IGL01737:Foxn1 APN 11 78360906 missense possibly damaging 0.81
IGL02669:Foxn1 APN 11 78371160 missense probably damaging 0.99
IGL03276:Foxn1 APN 11 78371124 missense probably benign 0.16
Nudnik UTSW 11 78361612 missense possibly damaging 0.52
R0200:Foxn1 UTSW 11 78361040 missense probably damaging 1.00
R0639:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R0739:Foxn1 UTSW 11 78358999 missense probably benign 0.01
R1112:Foxn1 UTSW 11 78371030 missense probably benign 0.29
R1167:Foxn1 UTSW 11 78359066 missense probably damaging 0.99
R1251:Foxn1 UTSW 11 78358785 missense probably damaging 0.99
R1474:Foxn1 UTSW 11 78361107 missense probably benign
R1506:Foxn1 UTSW 11 78365935 splice site probably benign
R1616:Foxn1 UTSW 11 78358866 missense probably benign 0.00
R1795:Foxn1 UTSW 11 78371225 missense probably benign 0.01
R1905:Foxn1 UTSW 11 78371810 splice site probably null
R1975:Foxn1 UTSW 11 78365937 splice site probably benign
R1976:Foxn1 UTSW 11 78365937 splice site probably benign
R2206:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2207:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2988:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R2989:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R5015:Foxn1 UTSW 11 78371163 missense probably damaging 1.00
R5140:Foxn1 UTSW 11 78361633 missense probably benign 0.18
R5533:Foxn1 UTSW 11 78365966 missense probably damaging 1.00
R6712:Foxn1 UTSW 11 78361259 missense probably damaging 1.00
R6852:Foxn1 UTSW 11 78360960 missense probably benign 0.00
R7176:Foxn1 UTSW 11 78360867 missense possibly damaging 0.94
R7331:Foxn1 UTSW 11 78358789 missense probably damaging 1.00
R7515:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R7562:Foxn1 UTSW 11 78371132 missense probably damaging 1.00
R7657:Foxn1 UTSW 11 78365964 missense probably benign 0.29
R8838:Foxn1 UTSW 11 78361612 missense possibly damaging 0.52
R9255:Foxn1 UTSW 11 78361573 nonsense probably null
R9512:Foxn1 UTSW 11 78371209 missense
X0067:Foxn1 UTSW 11 78361542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAAACCTGGGTCCCCTG -3'
(R):5'- GGTCCTCATTCTCATTGTAGCTGG -3'

Sequencing Primer
(F):5'- GTTCCATATCTGGGGAAACACC -3'
(R):5'- GCTTTCTTCGAGGCCAGGAC -3'
Posted On 2014-07-14