Mutagenetix > Incidental Mutations

Incidental Mutation 'R1964:Tet1'

217126

Institutional Source

Beutler Lab

Gene Symbol

Tet1

Ensembl Gene

ENSMUSG00000047146

Gene Name

tet methylcytosine dioxygenase 1

Synonyms

BB001228, 2510010B09Rik, D10Ertd17e, Cxxc6

MMRRC Submission

039977-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1964 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62804570-62908996 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 62812947 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1902 (D1902V)

Ref Sequence

ENSEMBL: ENSMUSP00000133279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174121] [ENSMUST00000174189]

Predicted Effect

probably benign
Transcript: ENSMUST00000050826
AA Change: D1870V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: D1870V

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
Pfam:zf-CXXC	566	607	2.5e-11	PFAM
low complexity region	884	902	N/A	INTRINSIC
low complexity region	1087	1106	N/A	INTRINSIC
Tet_JBP	1528	1931	1e-171	SMART
low complexity region	1944	1956	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173087

SMART Domains

Protein: ENSMUSP00000133706
Gene: ENSMUSG00000047146

Domain	Start	End	E-Value	Type
Tet_JBP	2	138	2.64e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173905

SMART Domains

Protein: ENSMUSP00000134571
Gene: ENSMUSG00000047146

Domain	Start	End	E-Value	Type
Pfam:Tet_JBP	1	61	2.4e-20	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174121
AA Change: D291V

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134328
Gene: ENSMUSG00000047146
AA Change: D291V

Domain	Start	End	E-Value	Type
Tet_JBP	1	352	1.49e-83	SMART
low complexity region	365	377	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174189
AA Change: D1902V

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: D1902V

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
Pfam:zf-CXXC	566	607	2.7e-10	PFAM
low complexity region	884	902	N/A	INTRINSIC
low complexity region	1087	1106	N/A	INTRINSIC
Tet_JBP	1528	1963	7.36e-170	SMART
low complexity region	1976	1988	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	C	T	17: 8,992,492	H158Y	probably damaging	Het
1810009J06Rik	T	A	6: 40,968,207	C207S	probably damaging	Het
Aadac	T	A	3: 60,037,338		probably null	Het
Abca6	T	A	11: 110,184,676	I1330F	probably damaging	Het
Adar	A	T	3: 89,745,895	S263C	probably benign	Het
Adra2b	T	C	2: 127,363,814	Y84H	probably damaging	Het
Arnt2	A	T	7: 84,343,789	V181E	possibly damaging	Het
Atg7	T	C	6: 114,706,230	L418P	probably damaging	Het
Atp2c1	A	G	9: 105,446,123	L181P	probably damaging	Het
Awat2	G	A	X: 100,404,559	P148S	probably damaging	Het
Birc6	A	G	17: 74,634,885	M2737V	possibly damaging	Het
Ccdc81	A	G	7: 89,886,153	C292R	probably benign	Het
Cd14	T	A	18: 36,726,339	E21V	probably damaging	Het
Cdc14b	A	C	13: 64,215,537	C303W	probably damaging	Het
Cdh23	T	C	10: 60,385,222	I1248V	probably benign	Het
Ceacam1	T	C	7: 25,474,708	D174G	probably benign	Het
Chd7	A	G	4: 8,865,978	M717V	probably damaging	Het
Cib1	T	C	7: 80,232,372	T20A	possibly damaging	Het
Clec4d	A	G	6: 123,262,360	K9R	probably benign	Het
Cntnap1	C	A	11: 101,178,024	S131*	probably null	Het
Crybg1	T	C	10: 43,958,330	K1581R	probably damaging	Het
Csf2	T	G	11: 54,248,458	T100P	probably benign	Het
Csrp2	T	A	10: 110,932,033	D26E	probably benign	Het
Cul1	T	C	6: 47,502,571	V257A	probably damaging	Het
Cul4a	G	A	8: 13,136,406	M505I	possibly damaging	Het
Cul4a	T	C	8: 13,136,854	M530T	probably benign	Het
Dcp2	T	C	18: 44,395,971	M51T	possibly damaging	Het
Ddx60	T	A	8: 61,948,869	C260S	probably benign	Het
Dennd2c	G	A	3: 103,166,491	R851H	probably damaging	Het
Dnah11	T	C	12: 118,142,292	E625G	possibly damaging	Het
Edem1	T	C	6: 108,844,947	W322R	probably benign	Het
Egflam	T	C	15: 7,247,105	T527A	probably damaging	Het
Ephb1	T	A	9: 101,971,123	M659L	possibly damaging	Het
Fbxl2	A	G	9: 113,989,169	I203T	probably benign	Het
Gabbr1	G	A	17: 37,048,459	G109R	probably damaging	Het
Gabra2	T	C	5: 71,014,450	I148V	possibly damaging	Het
Golga1	A	G	2: 39,047,087	V161A	probably benign	Het
Gps2	T	G	11: 69,916,420	S301A	probably benign	Het
H2-D1	T	C	17: 35,263,619	L105P	probably benign	Het
Igdcc4	T	C	9: 65,122,769	V367A	probably benign	Het
Igkv4-69	T	G	6: 69,283,798	Y115S	probably benign	Het
Itga5	A	G	15: 103,354,314	L309P	probably damaging	Het
Itih1	A	G	14: 30,929,623	Y871H	probably damaging	Het
Itpr2	T	A	6: 146,111,693	N2662I	probably damaging	Het
Kctd19	T	A	8: 105,388,470	E486D	probably damaging	Het
Kif5b	C	T	18: 6,209,059	R901Q	possibly damaging	Het
Kmt2a	G	A	9: 44,820,644	S2792F	probably benign	Het
Magi3	A	G	3: 104,020,402	V1023A	probably damaging	Het
Mapk9	C	A	11: 49,854,333	R25S	probably null	Het
Mb21d1	T	G	9: 78,437,455	Y228S	probably damaging	Het
Memo1	T	C	17: 74,245,008	T98A	possibly damaging	Het
Mill2	A	G	7: 18,856,604	K203R	probably damaging	Het
Mios	T	A	6: 8,215,798	H331Q	probably damaging	Het
Muc6	G	T	7: 141,640,062	S1566*	probably null	Het
Muc6	A	G	7: 141,640,063		probably benign	Het
Napsa	T	C	7: 44,581,685	F113L	probably benign	Het
Olfr1154	A	G	2: 87,903,667	V3A	probably benign	Het
Olfr198	T	A	16: 59,201,908	I173F	possibly damaging	Het
Oscp1	T	G	4: 126,083,622	V226G	possibly damaging	Het
Osgin2	G	T	4: 15,998,358	S421R	probably damaging	Het
Pclaf	A	G	9: 65,893,395	N50D	probably damaging	Het
Pdgfc	A	T	3: 81,174,985	I162F	probably benign	Het
Plag1	T	C	4: 3,903,956	T412A	probably benign	Het
Pogz	A	T	3: 94,878,193	T820S	probably benign	Het
Ptpn9	T	A	9: 57,059,912	V473D	probably damaging	Het
Qdpr	A	T	5: 45,439,318	M66K	possibly damaging	Het
Qrich1	A	G	9: 108,534,422	N382S	possibly damaging	Het
Rbbp8	T	C	18: 11,742,679	V883A	possibly damaging	Het
Rgl1	T	A	1: 152,549,104	I375F	probably damaging	Het
Rif1	C	T	2: 52,098,409	T720I	probably benign	Het
Rilp	A	T	11: 75,510,502	Q95L	probably benign	Het
Rnf169	T	A	7: 99,925,525	N621I	probably damaging	Het
Rps27a	T	C	11: 29,547,229	K27R	probably null	Het
Sar1a	T	C	10: 61,685,168	V54A	probably benign	Het
Sash1	T	A	10: 8,729,713	H971L	probably benign	Het
Sdk2	G	A	11: 113,781,017	Q2102*	probably null	Het
Serpina1e	T	A	12: 103,951,207	I68F	probably damaging	Het
Serpinb9e	A	C	13: 33,253,491	Q119P	probably benign	Het
Sh3tc2	A	T	18: 61,991,155	K965*	probably null	Het
Slc16a1	A	T	3: 104,649,466	S56C	probably damaging	Het
Slc26a11	T	A	11: 119,380,194	L563Q	possibly damaging	Het
Smarca2	G	T	19: 26,672,724	E24*	probably null	Het
Smgc	G	A	15: 91,860,270	G239D	probably damaging	Het
Sos2	A	T	12: 69,616,862	M616K	possibly damaging	Het
Thap2	C	T	10: 115,384,247	C10Y	probably damaging	Het
Tln2	T	C	9: 67,342,135	D890G	probably benign	Het
Tor2a	G	A	2: 32,758,704	G62D	probably damaging	Het
Ubqln5	A	T	7: 104,128,888	V243E	possibly damaging	Het
Utrn	A	T	10: 12,684,437	D1369E	probably damaging	Het
Vcan	A	G	13: 89,692,742	V1561A	probably benign	Het
Vmn1r70	T	C	7: 10,633,810	F56S	possibly damaging	Het
Vmn2r25	A	G	6: 123,823,295	L696S	possibly damaging	Het
Washc2	A	G	6: 116,208,987	T53A	probably damaging	Het
Wnk1	T	A	6: 119,934,382	T2417S	possibly damaging	Het
Zbtb49	A	T	5: 38,203,761	C12*	probably null	Het
Zfp472	C	A	17: 32,977,874	P308T	possibly damaging	Het

Other mutations in Tet1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Tet1	APN	10	62814497	missense	probably damaging	1.00
IGL01079:Tet1	APN	10	62879473	missense	probably damaging	0.99
IGL01109:Tet1	APN	10	62879774	missense	probably benign
IGL01634:Tet1	APN	10	62878588	missense	possibly damaging	0.94
IGL02003:Tet1	APN	10	62816400	missense	possibly damaging	0.92
IGL02081:Tet1	APN	10	62813818	missense	probably damaging	1.00
IGL02100:Tet1	APN	10	62812728	missense	possibly damaging	0.92
IGL02228:Tet1	APN	10	62813734	missense	probably damaging	0.99
IGL02524:Tet1	APN	10	62878646	missense	probably damaging	1.00
IGL02539:Tet1	APN	10	62813019	missense	possibly damaging	0.60
IGL02608:Tet1	APN	10	62879609	missense	possibly damaging	0.82
IGL02608:Tet1	APN	10	62839087	missense	probably damaging	1.00
IGL02702:Tet1	APN	10	62879752	missense	possibly damaging	0.83
K7371:Tet1	UTSW	10	62879176	missense	probably benign
R0166:Tet1	UTSW	10	62840279	missense	probably benign	0.05
R0371:Tet1	UTSW	10	62878399	missense	probably damaging	0.97
R0373:Tet1	UTSW	10	62878209	nonsense	probably null
R0391:Tet1	UTSW	10	62814546	splice site	probably null
R0445:Tet1	UTSW	10	62879941	missense	probably benign	0.08
R1016:Tet1	UTSW	10	62879950	missense	probably benign
R1344:Tet1	UTSW	10	62814521	missense	probably damaging	1.00
R1546:Tet1	UTSW	10	62812910	missense	probably damaging	1.00
R1651:Tet1	UTSW	10	62879674	missense	probably damaging	1.00
R1725:Tet1	UTSW	10	62814477	missense	probably damaging	1.00
R1752:Tet1	UTSW	10	62812989	missense	probably damaging	0.99
R1834:Tet1	UTSW	10	62813665	missense	probably damaging	0.99
R2239:Tet1	UTSW	10	62879734	missense	probably benign	0.01
R2962:Tet1	UTSW	10	62814544	nonsense	probably null
R3084:Tet1	UTSW	10	62879621	missense	probably benign	0.34
R3086:Tet1	UTSW	10	62879621	missense	probably benign	0.34
R3972:Tet1	UTSW	10	62813726	missense	probably damaging	1.00
R4622:Tet1	UTSW	10	62819474	missense	possibly damaging	0.92
R4674:Tet1	UTSW	10	62838848	missense	probably damaging	0.97
R4687:Tet1	UTSW	10	62838791	missense	probably benign	0.04
R4718:Tet1	UTSW	10	62813812	missense	probably damaging	0.96
R4801:Tet1	UTSW	10	62822663	missense	probably damaging	0.99
R4802:Tet1	UTSW	10	62822663	missense	probably damaging	0.99
R4903:Tet1	UTSW	10	62822658	missense	probably damaging	1.00
R5153:Tet1	UTSW	10	62878578	missense	possibly damaging	0.85
R5193:Tet1	UTSW	10	62838247	missense	probably benign	0.22
R5225:Tet1	UTSW	10	62838671	missense	probably damaging	1.00
R5437:Tet1	UTSW	10	62814451	missense	probably benign	0.01
R5465:Tet1	UTSW	10	62839777	missense	probably benign
R5535:Tet1	UTSW	10	62832907	missense	probably damaging	1.00
R5586:Tet1	UTSW	10	62878294	missense	probably damaging	1.00
R5763:Tet1	UTSW	10	62840068	missense	probably damaging	1.00
R5788:Tet1	UTSW	10	62839958	missense	possibly damaging	0.70
R5818:Tet1	UTSW	10	62816408	missense	possibly damaging	0.71
R5860:Tet1	UTSW	10	62812620	splice site	probably null
R5975:Tet1	UTSW	10	62879773	missense	probably benign	0.37
R6041:Tet1	UTSW	10	62813373	missense	probably damaging	0.98
R6092:Tet1	UTSW	10	62813715	missense	probably benign	0.10
R6132:Tet1	UTSW	10	62813300	missense	probably damaging	0.99
R6157:Tet1	UTSW	10	62839970	missense	probably damaging	0.98
R6520:Tet1	UTSW	10	62880013	start codon destroyed	probably null	0.53
R7210:Tet1	UTSW	10	62814501	missense	probably null	0.95
R7223:Tet1	UTSW	10	62813671	missense	possibly damaging	0.95
R7255:Tet1	UTSW	10	62822636	missense	probably benign	0.15
R7323:Tet1	UTSW	10	62880039	start gained	probably benign
R7472:Tet1	UTSW	10	62813350	missense	possibly damaging	0.84
R7507:Tet1	UTSW	10	62832892	critical splice donor site	probably null
R7522:Tet1	UTSW	10	62818983	missense	possibly damaging	0.82
R7849:Tet1	UTSW	10	62819473	missense	possibly damaging	0.83
R7879:Tet1	UTSW	10	62879046	missense	probably benign	0.03
R8073:Tet1	UTSW	10	62813353	missense	probably damaging	0.98
R8098:Tet1	UTSW	10	62879080	missense	probably damaging	1.00
R8147:Tet1	UTSW	10	62878807	missense	probably benign	0.01
R8355:Tet1	UTSW	10	62816450	missense	possibly damaging	0.89
R8545:Tet1	UTSW	10	62812939	missense	probably damaging	1.00
R8556:Tet1	UTSW	10	62840206	missense	probably benign	0.37
Z1177:Tet1	UTSW	10	62818985	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTGTGCTGGTAGAATACAAGGG -3'
(R):5'- TGCTGGGGAATGTACTGGAAC -3'

Sequencing Primer
(F):5'- TGCTGGTAGAATACAAGGGACACAC -3'
(R):5'- AGGTGGCTGCTCATCCTCAC -3'

Posted On

2014-08-01