Incidental Mutation 'R0136:Hnrnpul2'
Institutional Source Beutler Lab
Gene Symbol Hnrnpul2
Ensembl Gene ENSMUSG00000071659
Gene Nameheterogeneous nuclear ribonucleoprotein U-like 2
Synonyms1110031M08Rik, Hnrpul2
MMRRC Submission 038421-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R0136 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location8819401-8834142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8826801 bp
Amino Acid Change Leucine to Proline at position 588 (L588P)
Ref Sequence ENSEMBL: ENSMUSP00000094515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096753]
Predicted Effect probably damaging
Transcript: ENSMUST00000096753
AA Change: L588P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094515
Gene: ENSMUSG00000071659
AA Change: L588P

SAP 3 37 6.03e-9 SMART
low complexity region 68 126 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
SPRY 287 416 5.23e-32 SMART
Pfam:AAA_33 452 597 1.2e-25 PFAM
low complexity region 637 666 N/A INTRINSIC
low complexity region 700 719 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Meta Mutation Damage Score 0.4868 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 T C 12: 79,150,006 L167P probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Bcl3 A G 7: 19,809,569 V324A probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hipk3 A G 2: 104,439,293 I517T probably benign Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Med13l A G 5: 118,724,050 T353A probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nsd3 G T 8: 25,659,854 E352* probably null Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc12a8 A G 16: 33,608,213 D297G probably damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Slc26a5 T C 5: 21,834,347 N216S probably damaging Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Ybx1 C A 4: 119,282,354 R36L possibly damaging Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Hnrnpul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Hnrnpul2 APN 19 8823628 missense probably damaging 1.00
R0369:Hnrnpul2 UTSW 19 8824413 missense probably damaging 1.00
R0781:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R0784:Hnrnpul2 UTSW 19 8825052 missense possibly damaging 0.82
R1110:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R1227:Hnrnpul2 UTSW 19 8823237 missense possibly damaging 0.91
R1589:Hnrnpul2 UTSW 19 8831332 missense probably benign 0.00
R2126:Hnrnpul2 UTSW 19 8824438 nonsense probably null
R2226:Hnrnpul2 UTSW 19 8824985 missense probably damaging 0.96
R2243:Hnrnpul2 UTSW 19 8820637 missense probably benign
R3703:Hnrnpul2 UTSW 19 8824409 missense probably damaging 1.00
R4038:Hnrnpul2 UTSW 19 8823227 unclassified probably benign
R4856:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R4886:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R5016:Hnrnpul2 UTSW 19 8822825 missense possibly damaging 0.94
R5365:Hnrnpul2 UTSW 19 8820716 missense probably benign
R5435:Hnrnpul2 UTSW 19 8820318 missense probably benign 0.32
R5951:Hnrnpul2 UTSW 19 8824891 missense probably damaging 1.00
R6181:Hnrnpul2 UTSW 19 8823232 missense possibly damaging 0.70
R6824:Hnrnpul2 UTSW 19 8826717 missense possibly damaging 0.89
R6924:Hnrnpul2 UTSW 19 8831509 missense unknown
R6978:Hnrnpul2 UTSW 19 8824276 missense probably damaging 1.00
R7602:Hnrnpul2 UTSW 19 8831309 missense probably damaging 0.99
R7688:Hnrnpul2 UTSW 19 8820630 missense probably benign
R7726:Hnrnpul2 UTSW 19 8831280 missense possibly damaging 0.61
R7749:Hnrnpul2 UTSW 19 8820424 missense probably benign
R7753:Hnrnpul2 UTSW 19 8824972 missense probably damaging 1.00
R8007:Hnrnpul2 UTSW 19 8820815 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ggtcctgattaccacaaCGCAATGATA -3'

Sequencing Primer
(F):5'- attaccacaaCGCAATGATAATAGTG -3'
(R):5'- tctctcctaactcatagtcttctttc -3'
Posted On2013-04-12