Incidental Mutation 'R0136:Med13l'
ID21943
Institutional Source Beutler Lab
Gene Symbol Med13l
Ensembl Gene ENSMUSG00000018076
Gene Namemediator complex subunit 13-like
Synonyms9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L
MMRRC Submission 038421-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R0136 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location118560679-118765438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118724050 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 353 (T353A)
Ref Sequence ENSEMBL: ENSMUSP00000098379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]
Predicted Effect probably benign
Transcript: ENSMUST00000100816
AA Change: T353A

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 2.5e-116 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2197 1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201010
AA Change: T353A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 1e-112 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2206 1.7e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201614
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 T C 12: 79,150,006 L167P probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Bcl3 A G 7: 19,809,569 V324A probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hipk3 A G 2: 104,439,293 I517T probably benign Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Hnrnpul2 T C 19: 8,826,801 L588P probably damaging Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nsd3 G T 8: 25,659,854 E352* probably null Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc12a8 A G 16: 33,608,213 D297G probably damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Slc26a5 T C 5: 21,834,347 N216S probably damaging Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Ybx1 C A 4: 119,282,354 R36L possibly damaging Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Med13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Med13l APN 5 118724071 missense probably damaging 0.99
IGL01012:Med13l APN 5 118734028 missense probably damaging 0.99
IGL01316:Med13l APN 5 118762781 missense probably damaging 1.00
IGL01529:Med13l APN 5 118742335 missense probably damaging 1.00
IGL01731:Med13l APN 5 118742407 missense probably benign 0.05
IGL01790:Med13l APN 5 118593522 missense probably damaging 1.00
IGL02394:Med13l APN 5 118748833 missense probably benign 0.37
IGL02432:Med13l APN 5 118738400 missense possibly damaging 0.90
IGL02698:Med13l APN 5 118762829 missense probably damaging 0.99
IGL02801:Med13l APN 5 118745113 missense probably damaging 1.00
IGL03242:Med13l APN 5 118747445 missense probably benign
IGL03270:Med13l APN 5 118731430 missense probably damaging 1.00
Basics UTSW 5 118759264 critical splice donor site probably null
Fundament UTSW 5 118721474 missense probably damaging 1.00
Root UTSW 5 118593445 missense probably damaging 1.00
P0035:Med13l UTSW 5 118742620 missense probably benign 0.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0158:Med13l UTSW 5 118742449 missense unknown
R0197:Med13l UTSW 5 118671002 splice site probably benign
R0370:Med13l UTSW 5 118741826 missense probably benign 0.14
R0492:Med13l UTSW 5 118738495 missense probably damaging 1.00
R0532:Med13l UTSW 5 118759123 missense possibly damaging 0.78
R0726:Med13l UTSW 5 118748684 missense probably damaging 0.99
R0738:Med13l UTSW 5 118751633 missense probably damaging 0.99
R0827:Med13l UTSW 5 118726247 splice site probably benign
R0883:Med13l UTSW 5 118671002 splice site probably benign
R0959:Med13l UTSW 5 118754285 missense possibly damaging 0.89
R1458:Med13l UTSW 5 118738459 missense probably benign 0.00
R1562:Med13l UTSW 5 118738519 missense probably damaging 1.00
R1577:Med13l UTSW 5 118721392 missense probably damaging 1.00
R1661:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1665:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1720:Med13l UTSW 5 118741995 missense probably damaging 1.00
R1929:Med13l UTSW 5 118728833 missense probably benign 0.01
R1967:Med13l UTSW 5 118761322 missense probably damaging 0.99
R2301:Med13l UTSW 5 118593447 missense probably damaging 1.00
R3691:Med13l UTSW 5 118721497 missense probably benign 0.16
R3895:Med13l UTSW 5 118761323 missense probably null 0.99
R4043:Med13l UTSW 5 118593463 missense probably damaging 1.00
R4593:Med13l UTSW 5 118742560 missense probably damaging 1.00
R4902:Med13l UTSW 5 118745130 missense probably damaging 1.00
R4995:Med13l UTSW 5 118730949 missense possibly damaging 0.90
R5010:Med13l UTSW 5 118593550 missense possibly damaging 0.95
R5057:Med13l UTSW 5 118718493 missense probably damaging 1.00
R5369:Med13l UTSW 5 118724010 missense probably benign 0.02
R5446:Med13l UTSW 5 118742397 missense possibly damaging 0.81
R5564:Med13l UTSW 5 118742040 missense probably damaging 1.00
R5566:Med13l UTSW 5 118728665 missense possibly damaging 0.95
R5580:Med13l UTSW 5 118751630 missense possibly damaging 0.95
R5634:Med13l UTSW 5 118560850 missense possibly damaging 0.88
R5748:Med13l UTSW 5 118593445 missense probably damaging 1.00
R5764:Med13l UTSW 5 118728642 missense probably damaging 0.99
R5765:Med13l UTSW 5 118728642 missense probably damaging 0.99
R6083:Med13l UTSW 5 118721486 missense possibly damaging 0.80
R6504:Med13l UTSW 5 118754321 missense probably benign 0.34
R6546:Med13l UTSW 5 118721474 missense probably damaging 1.00
R6797:Med13l UTSW 5 118759264 critical splice donor site probably null
R6911:Med13l UTSW 5 118755658 missense possibly damaging 0.95
R6942:Med13l UTSW 5 118745006 splice site probably null
R7018:Med13l UTSW 5 118751986 missense probably damaging 0.99
R7096:Med13l UTSW 5 118721926 missense possibly damaging 0.90
R7113:Med13l UTSW 5 118726265 missense probably benign 0.09
R7136:Med13l UTSW 5 118721522 missense possibly damaging 0.90
R7140:Med13l UTSW 5 118741972 missense probably benign 0.27
R7345:Med13l UTSW 5 118742760 missense probably damaging 1.00
R7409:Med13l UTSW 5 118754321 missense probably benign 0.34
R7410:Med13l UTSW 5 118560832 missense possibly damaging 0.94
R7432:Med13l UTSW 5 118751938 missense probably damaging 0.99
R7486:Med13l UTSW 5 118728474 missense probably benign 0.17
R7509:Med13l UTSW 5 118748930 missense probably damaging 0.97
R7722:Med13l UTSW 5 118747407 missense probably benign 0.32
R7802:Med13l UTSW 5 118728590 missense probably benign 0.03
X0065:Med13l UTSW 5 118729883 missense probably damaging 1.00
Z1088:Med13l UTSW 5 118749641 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTGTGGGGAAGATTCTCTCATCC -3'
(R):5'- AGCTGTACTTGTGACTGACTTGCC -3'

Sequencing Primer
(F):5'- AGATTCTCTCATCCCTGTAGATAGTG -3'
(R):5'- GTGACTGACTTGCCCTCTTC -3'
Posted On2013-04-12