Incidental Mutation 'R2066:Bdnf'
ID226646
Institutional Source Beutler Lab
Gene Symbol Bdnf
Ensembl Gene ENSMUSG00000048482
Gene Namebrain derived neurotrophic factor
Synonyms
MMRRC Submission 040071-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R2066 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109674700-109727007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109723902 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 207 (T207K)
Ref Sequence ENSEMBL: ENSMUSP00000106671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053317] [ENSMUST00000111042] [ENSMUST00000111043] [ENSMUST00000111044] [ENSMUST00000111045] [ENSMUST00000111046] [ENSMUST00000111047] [ENSMUST00000111049] [ENSMUST00000111050] [ENSMUST00000111051] [ENSMUST00000176893]
Predicted Effect probably damaging
Transcript: ENSMUST00000053317
AA Change: T175K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057989
Gene: ENSMUSG00000048482
AA Change: T175K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
NGF 143 250 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111042
AA Change: T207K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106671
Gene: ENSMUSG00000048482
AA Change: T207K

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
NGF 175 282 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111043
AA Change: T167K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106672
Gene: ENSMUSG00000048482
AA Change: T167K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111044
AA Change: T167K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106673
Gene: ENSMUSG00000048482
AA Change: T167K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111045
AA Change: T167K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106674
Gene: ENSMUSG00000048482
AA Change: T167K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111046
AA Change: T167K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106675
Gene: ENSMUSG00000048482
AA Change: T167K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111047
AA Change: T167K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106676
Gene: ENSMUSG00000048482
AA Change: T167K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111049
AA Change: T167K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106678
Gene: ENSMUSG00000048482
AA Change: T167K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111050
AA Change: T167K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106679
Gene: ENSMUSG00000048482
AA Change: T167K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111051
AA Change: T167K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106680
Gene: ENSMUSG00000048482
AA Change: T167K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176893
AA Change: T167K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135762
Gene: ENSMUSG00000048482
AA Change: T167K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Meta Mutation Damage Score 0.5908 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the nerve growth factor family. It is involved in the growth, differentiation and survival of specific types of developing neurons both in the central nervous system (CNS) and the peripheral nervous system. It is also involved in regulating synaptic plasticity in the CNS. Expression of a similar gene in human is reduced in both Alzheimer's and Huntington disease patients. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for targeted null alleles exhibit sensory neuron losses affecting coordination, balance, hearing, taste, and breathing, cerebellar abnormalities, increased sympathetic neuron number, and postnatal lethality. Carriers show mild defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Acadl C T 1: 66,841,746 probably null Het
Acss1 G A 2: 150,668,131 Q23* probably null Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano5 T G 7: 51,585,386 L639R probably damaging Het
Arhgap26 T C 18: 39,306,728 S71P probably damaging Het
B3gnt2 A G 11: 22,836,735 L151P probably damaging Het
Bach1 A T 16: 87,729,625 K658N probably damaging Het
Bod1l G T 5: 41,805,156 T2746K probably damaging Het
Brwd1 A G 16: 96,046,465 S652P probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clasp2 T A 9: 113,906,157 I1021N possibly damaging Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cntn6 C T 6: 104,861,822 R946* probably null Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnajc13 A T 9: 104,221,441 I471N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Emx2 A G 19: 59,461,698 N149S probably benign Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Filip1 A G 9: 79,820,216 S374P probably damaging Het
Fry T A 5: 150,370,119 probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Hdlbp A G 1: 93,421,880 probably benign Het
Hunk G A 16: 90,481,245 probably null Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Ints1 A G 5: 139,767,496 V720A probably benign Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Jpt2 G A 17: 24,948,739 Q79* probably null Het
Lingo2 A G 4: 35,709,179 L267P probably benign Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Meiob G T 17: 24,818,316 R56L probably damaging Het
Mindy3 A T 2: 12,419,249 S2T probably damaging Het
Mrm3 A T 11: 76,250,321 D385V probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nbea A G 3: 55,968,146 V1701A probably damaging Het
Nipal4 T G 11: 46,156,795 D104A probably damaging Het
Npas4 A G 19: 4,987,414 V284A probably damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Obscn G A 11: 59,135,732 A215V possibly damaging Het
Olfr1218 A G 2: 89,054,899 Y176H probably damaging Het
Olfr870 G T 9: 20,171,554 Q6K probably benign Het
Olfr938 T C 9: 39,078,214 Y177C probably damaging Het
Pgs1 G A 11: 118,014,570 probably benign Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phldb2 A T 16: 45,770,758 L970Q probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppip5k1 A G 2: 121,342,871 probably benign Het
Prune2 A G 19: 17,120,678 D1182G possibly damaging Het
Psg25 G A 7: 18,529,562 T112I probably damaging Het
Sec61g T C 11: 16,508,124 T24A probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Sorbs1 T C 19: 40,365,028 probably null Het
Sox2 C A 3: 34,651,307 Q298K possibly damaging Het
Spatc1 T A 15: 76,283,537 probably null Het
Szt2 T C 4: 118,373,980 M2529V unknown Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tpp2 T G 1: 43,978,438 I734S possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ttc28 C A 5: 111,225,933 F1078L probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Zdhhc13 T A 7: 48,816,427 V284D probably benign Het
Zfp668 C A 7: 127,867,031 R327L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Bdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Bdnf APN 2 109723547 missense probably benign 0.02
IGL01285:Bdnf APN 2 109723586 missense probably benign 0.02
IGL01595:Bdnf APN 2 109723928 nonsense probably null
IGL01737:Bdnf APN 2 109723755 missense probably damaging 1.00
IGL02450:Bdnf APN 2 109723604 missense possibly damaging 0.75
IGL02793:Bdnf APN 2 109723851 missense probably damaging 1.00
IGL02875:Bdnf APN 2 109723851 missense probably damaging 1.00
R0505:Bdnf UTSW 2 109675343 splice site probably null
R0626:Bdnf UTSW 2 109723538 missense probably benign 0.01
R0792:Bdnf UTSW 2 109724118 missense probably damaging 1.00
R1568:Bdnf UTSW 2 109723794 missense probably damaging 1.00
R4704:Bdnf UTSW 2 109723692 missense possibly damaging 0.89
R5000:Bdnf UTSW 2 109723648 missense probably benign 0.01
R5259:Bdnf UTSW 2 109723982 missense probably benign 0.37
R5301:Bdnf UTSW 2 109723539 missense probably benign
R6344:Bdnf UTSW 2 109723677 missense probably benign 0.01
R7392:Bdnf UTSW 2 109723930 missense probably benign 0.01
X0028:Bdnf UTSW 2 109723883 missense possibly damaging 0.77
X0058:Bdnf UTSW 2 109723637 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTACACTTCCCGGGTGATG -3'
(R):5'- CTATCCATAGTAAGGGCCCGAAC -3'

Sequencing Primer
(F):5'- TGATGCTCAGCAGTCAAGTGC -3'
(R):5'- CCCGAACATACGATTGGGTAGTTC -3'
Posted On2014-09-17