Incidental Mutation 'R1568:Bdnf'
ID 175395
Institutional Source Beutler Lab
Gene Symbol Bdnf
Ensembl Gene ENSMUSG00000048482
Gene Name brain derived neurotrophic factor
Synonyms
MMRRC Submission 039607-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R1568 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 109505045-109557352 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109554139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 131 (H131R)
Ref Sequence ENSEMBL: ENSMUSP00000135762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053317] [ENSMUST00000111042] [ENSMUST00000111043] [ENSMUST00000111044] [ENSMUST00000111045] [ENSMUST00000111046] [ENSMUST00000111047] [ENSMUST00000111049] [ENSMUST00000111050] [ENSMUST00000176893] [ENSMUST00000111051]
AlphaFold P21237
Predicted Effect probably damaging
Transcript: ENSMUST00000053317
AA Change: H139R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057989
Gene: ENSMUSG00000048482
AA Change: H139R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
NGF 143 250 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111042
AA Change: H171R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106671
Gene: ENSMUSG00000048482
AA Change: H171R

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
NGF 175 282 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111043
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106672
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111044
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106673
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111045
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106674
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111046
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106675
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111047
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106676
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111049
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106678
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111050
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106679
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176893
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135762
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111051
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106680
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the nerve growth factor family. It is involved in the growth, differentiation and survival of specific types of developing neurons both in the central nervous system (CNS) and the peripheral nervous system. It is also involved in regulating synaptic plasticity in the CNS. Expression of a similar gene in human is reduced in both Alzheimer's and Huntington disease patients. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for targeted null alleles exhibit sensory neuron losses affecting coordination, balance, hearing, taste, and breathing, cerebellar abnormalities, increased sympathetic neuron number, and postnatal lethality. Carriers show mild defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T G 8: 25,137,799 (GRCm39) probably null Het
Adgb A T 10: 10,318,409 (GRCm39) Y138* probably null Het
Adra1d T C 2: 131,388,092 (GRCm39) R488G possibly damaging Het
Ahnak G A 19: 8,979,739 (GRCm39) G341E probably damaging Het
Ankmy1 T C 1: 92,808,838 (GRCm39) D690G probably damaging Het
Arhgef38 C T 3: 132,838,225 (GRCm39) E21K probably damaging Het
Atp8b2 T C 3: 89,857,155 (GRCm39) M402V probably damaging Het
Atp8b4 G T 2: 126,167,314 (GRCm39) H1062N probably benign Het
Cblb C T 16: 51,956,192 (GRCm39) T265M probably damaging Het
Cenpe T A 3: 134,945,519 (GRCm39) M1011K probably benign Het
Clca3a2 A T 3: 144,781,410 (GRCm39) Y711* probably null Het
Clca4a A G 3: 144,658,690 (GRCm39) Y842H probably benign Het
Clspn T A 4: 126,475,310 (GRCm39) M1021K probably benign Het
Cpne8 G T 15: 90,503,845 (GRCm39) R107S probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Dnah5 T A 15: 28,409,323 (GRCm39) N3580K probably damaging Het
Dsp T C 13: 38,359,123 (GRCm39) I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 (GRCm39) K858R probably null Het
Fasn A T 11: 120,704,075 (GRCm39) V1448E possibly damaging Het
Ghdc A G 11: 100,659,331 (GRCm39) I322T probably benign Het
Gins2 T C 8: 121,308,939 (GRCm39) D105G probably damaging Het
Insr A T 8: 3,215,576 (GRCm39) D975E probably benign Het
Klrc3 T C 6: 129,616,510 (GRCm39) D169G probably benign Het
Krt76 T A 15: 101,793,443 (GRCm39) S532C unknown Het
Lamp3 A T 16: 19,492,275 (GRCm39) M323K probably damaging Het
Lgmn T C 12: 102,360,868 (GRCm39) I423M possibly damaging Het
Lpgat1 A T 1: 191,508,538 (GRCm39) T359S possibly damaging Het
Lrguk T A 6: 34,063,373 (GRCm39) I466N probably damaging Het
Magi3 A C 3: 103,996,843 (GRCm39) M234R probably benign Het
Myh14 G A 7: 44,261,122 (GRCm39) R1042* probably null Het
Nfia T G 4: 97,999,461 (GRCm39) Y378D possibly damaging Het
Npffr1 T A 10: 61,462,012 (GRCm39) S383T possibly damaging Het
Or4f57 C A 2: 111,790,585 (GRCm39) V278F probably benign Het
Or52n4 T A 7: 104,293,977 (GRCm39) I199F probably benign Het
Or5b112 C A 19: 13,319,539 (GRCm39) P139Q probably benign Het
Or9s14 T C 1: 92,535,676 (GRCm39) L39P probably damaging Het
Osr1 G A 12: 9,629,798 (GRCm39) probably null Het
Pde4b A C 4: 102,454,896 (GRCm39) R375S probably damaging Het
Pde8a A G 7: 80,942,011 (GRCm39) E150G probably damaging Het
Pkhd1l1 A T 15: 44,408,897 (GRCm39) probably null Het
Ppp3ca A G 3: 136,634,305 (GRCm39) T422A probably benign Het
Proser1 T C 3: 53,385,180 (GRCm39) V354A possibly damaging Het
Rgs20 G T 1: 5,091,050 (GRCm39) R127S probably benign Het
Sanbr T C 11: 23,539,971 (GRCm39) K48E probably damaging Het
Sec22a T C 16: 35,167,998 (GRCm39) D171G probably benign Het
Secisbp2 A G 13: 51,827,143 (GRCm39) E417G possibly damaging Het
Serpinb6b T C 13: 33,158,895 (GRCm39) L32S probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Slc39a10 A T 1: 46,865,375 (GRCm39) S487T probably benign Het
Slc6a1 G T 6: 114,284,731 (GRCm39) G263V probably damaging Het
Spag6 A G 2: 18,737,925 (GRCm39) D265G probably benign Het
Spata31e2 T C 1: 26,724,950 (GRCm39) T77A probably benign Het
Sybu G T 15: 44,582,228 (GRCm39) S132* probably null Het
Virma T C 4: 11,528,776 (GRCm39) S1288P probably damaging Het
Vmn1r229 T A 17: 21,035,067 (GRCm39) V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 (GRCm39) T19A probably benign Het
Vmn2r86 C T 10: 130,289,010 (GRCm39) V164I probably benign Het
Wfdc13 G T 2: 164,528,854 (GRCm39) A64S probably damaging Het
Zfp873 C A 10: 81,896,113 (GRCm39) H318Q probably damaging Het
Zyg11a A G 4: 108,040,843 (GRCm39) probably null Het
Other mutations in Bdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Bdnf APN 2 109,553,892 (GRCm39) missense probably benign 0.02
IGL01285:Bdnf APN 2 109,553,931 (GRCm39) missense probably benign 0.02
IGL01595:Bdnf APN 2 109,554,273 (GRCm39) nonsense probably null
IGL01737:Bdnf APN 2 109,554,100 (GRCm39) missense probably damaging 1.00
IGL02450:Bdnf APN 2 109,553,949 (GRCm39) missense possibly damaging 0.75
IGL02793:Bdnf APN 2 109,554,196 (GRCm39) missense probably damaging 1.00
IGL02875:Bdnf APN 2 109,554,196 (GRCm39) missense probably damaging 1.00
R0505:Bdnf UTSW 2 109,505,688 (GRCm39) splice site probably null
R0626:Bdnf UTSW 2 109,553,883 (GRCm39) missense probably benign 0.01
R0792:Bdnf UTSW 2 109,554,463 (GRCm39) missense probably damaging 1.00
R2066:Bdnf UTSW 2 109,554,247 (GRCm39) missense probably damaging 1.00
R4704:Bdnf UTSW 2 109,554,037 (GRCm39) missense possibly damaging 0.89
R5000:Bdnf UTSW 2 109,553,993 (GRCm39) missense probably benign 0.01
R5259:Bdnf UTSW 2 109,554,327 (GRCm39) missense probably benign 0.37
R5301:Bdnf UTSW 2 109,553,884 (GRCm39) missense probably benign
R6344:Bdnf UTSW 2 109,554,022 (GRCm39) missense probably benign 0.01
R7392:Bdnf UTSW 2 109,554,275 (GRCm39) missense probably benign 0.01
R9481:Bdnf UTSW 2 109,553,935 (GRCm39) missense possibly damaging 0.69
R9558:Bdnf UTSW 2 109,539,999 (GRCm39) missense
R9702:Bdnf UTSW 2 109,554,117 (GRCm39) missense possibly damaging 0.85
X0028:Bdnf UTSW 2 109,554,228 (GRCm39) missense possibly damaging 0.77
X0058:Bdnf UTSW 2 109,553,982 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGACACTTTTGAGCACGTCATC -3'
(R):5'- CATTGCGAGTTCCAGTGCCTTTTG -3'

Sequencing Primer
(F):5'- TTTTGAGCACGTCATCGAAGAG -3'
(R):5'- GCAGCCTTCCTTGGTGTAAC -3'
Posted On 2014-04-24