Incidental Mutation 'R0157:Zfp26'
ID22919
Institutional Source Beutler Lab
Gene Symbol Zfp26
Ensembl Gene ENSMUSG00000063108
Gene Namezinc finger protein 26
SynonymsZfp70, KRAB15, Zfp81-rs1, Zfp-26, 5033428C05Rik, mkr-3
MMRRC Submission 038437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0157 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location20428449-20460162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20437870 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 466 (T466K)
Ref Sequence ENSEMBL: ENSMUSP00000124075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159569]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098970
Predicted Effect probably benign
Transcript: ENSMUST00000159569
AA Change: T466K

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124075
Gene: ENSMUSG00000063108
AA Change: T466K

DomainStartEndE-ValueType
Blast:KRAB 40 93 3e-6 BLAST
KRAB 107 167 4.28e-32 SMART
ZnF_C2H2 289 311 3.34e-2 SMART
ZnF_C2H2 344 366 3.63e-3 SMART
ZnF_C2H2 372 394 4.54e-4 SMART
ZnF_C2H2 400 422 2.65e-5 SMART
ZnF_C2H2 428 450 1.12e-3 SMART
ZnF_C2H2 456 478 9.08e-4 SMART
ZnF_C2H2 484 506 7.9e-4 SMART
ZnF_C2H2 512 534 2.43e-4 SMART
ZnF_C2H2 540 562 1.36e-2 SMART
ZnF_C2H2 568 590 3.44e-4 SMART
ZnF_C2H2 596 618 6.52e-5 SMART
ZnF_C2H2 624 646 2.32e-1 SMART
ZnF_C2H2 652 674 9.22e-5 SMART
ZnF_C2H2 680 702 1.22e-4 SMART
ZnF_C2H2 708 730 4.87e-4 SMART
ZnF_C2H2 736 758 4.54e-4 SMART
ZnF_C2H2 764 786 3.44e-4 SMART
ZnF_C2H2 792 814 5.21e-4 SMART
ZnF_C2H2 820 842 3.44e-4 SMART
ZnF_C2H2 848 870 5.14e-3 SMART
ZnF_C2H2 876 898 2.79e-4 SMART
ZnF_C2H2 904 926 2.12e-4 SMART
ZnF_C2H2 932 954 9.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.5%
Validation Efficiency 64% (47/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T A 11: 80,165,701 I180N probably damaging Het
Alk T A 17: 71,949,845 N673I probably benign Het
Ankrd7 T C 6: 18,866,540 S20P probably damaging Het
Arhgef26 T G 3: 62,380,971 D487E probably damaging Het
Arhgef4 A G 1: 34,806,394 D1500G probably damaging Het
Arhgef7 A G 8: 11,785,812 I39V probably damaging Het
Asap2 T A 12: 21,206,325 I208N probably damaging Het
Atad5 T C 11: 80,089,817 V16A possibly damaging Het
Atp2b1 T C 10: 98,999,947 I518T probably damaging Het
B130006D01Rik T C 11: 95,726,385 probably benign Het
BC028528 A G 3: 95,884,968 probably null Het
Bpifb6 T A 2: 153,903,966 L74Q probably benign Het
Bptf T C 11: 107,074,658 T1122A possibly damaging Het
Cacna2d4 T A 6: 119,312,424 D806E probably benign Het
Cdhr3 T C 12: 33,061,650 Q287R possibly damaging Het
Cdk12 A G 11: 98,249,776 probably benign Het
Cenpf T A 1: 189,652,359 T2575S probably benign Het
Chd7 T A 4: 8,833,759 I1171N probably damaging Het
Chd9 T C 8: 91,008,836 probably null Het
Ckmt1 A G 2: 121,363,041 T361A possibly damaging Het
Clec4d G T 6: 123,267,136 R68L probably benign Het
Csmd2 G T 4: 128,521,911 V2678F probably benign Het
Cul7 T A 17: 46,653,835 V131E possibly damaging Het
Dab2 T C 15: 6,429,827 S407P probably benign Het
Dnah17 C T 11: 118,127,171 G166D probably benign Het
F13b G A 1: 139,503,847 V52I probably benign Het
Fam208b C A 13: 3,575,550 V1467L probably benign Het
Gjd4 T C 18: 9,280,549 I176M probably benign Het
Gm13083 C T 4: 143,615,796 P158S probably damaging Het
Gm4969 T C 7: 19,107,020 H63R possibly damaging Het
Hoxc11 A G 15: 102,955,001 Y159C probably damaging Het
Hydin T C 8: 110,300,010 I120T possibly damaging Het
Il20rb A G 9: 100,473,079 Y104H probably damaging Het
Krtap21-1 A G 16: 89,403,542 C71R unknown Het
Lamc1 T C 1: 153,262,607 D167G probably benign Het
Lin7c C A 2: 109,895,169 A73E probably damaging Het
Mms22l C A 4: 24,588,224 A952E probably damaging Het
Myh3 A G 11: 67,082,909 N136S probably benign Het
Ndufb10 T C 17: 24,724,244 T31A probably benign Het
Nlrp2 T C 7: 5,308,770 Y37C possibly damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Olfr314 T C 11: 58,787,059 F275S probably damaging Het
Orc3 C A 4: 34,607,130 probably null Het
Pard3b A C 1: 62,211,633 M512L probably damaging Het
Pcdh10 A G 3: 45,379,701 D150G probably damaging Het
Pcolce A T 5: 137,610,479 probably null Het
Pdcl A C 2: 37,352,177 I187S probably damaging Het
Pkn1 T C 8: 83,692,820 I51M probably damaging Het
Pla2g4e T A 2: 120,170,181 T692S probably benign Het
Plcb2 C A 2: 118,718,541 V380F probably damaging Het
Pmpcb A T 5: 21,742,952 I218F probably damaging Het
Pms1 A T 1: 53,195,037 Y773* probably null Het
Polr2e C T 10: 80,036,781 G184R probably damaging Het
Polr3a T C 14: 24,479,186 I369V probably damaging Het
Prpf4b T C 13: 34,884,031 probably benign Het
Pzp G A 6: 128,523,976 Q140* probably null Het
Qrich2 T A 11: 116,441,395 E2325V probably damaging Het
R3hdm2 T G 10: 127,471,989 L373R probably damaging Het
Sema3d A T 5: 12,508,137 D212V possibly damaging Het
Sidt2 A G 9: 45,939,267 I850T probably damaging Het
Slc22a29 C T 19: 8,162,742 R433H possibly damaging Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sox21 G A 14: 118,235,942 probably benign Het
Steap3 A G 1: 120,227,649 *527R probably null Het
Svep1 T C 4: 58,069,830 E2652G possibly damaging Het
Taar2 T A 10: 23,941,491 F310I probably damaging Het
Tecta A G 9: 42,375,011 V783A probably benign Het
Vmn1r173 T A 7: 23,702,397 I19N probably damaging Het
Vwa5b1 T A 4: 138,604,879 M276L probably benign Het
Yeats2 A C 16: 20,221,677 *142C probably null Het
Zfp426 T C 9: 20,471,136 N171S probably benign Het
Other mutations in Zfp26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Zfp26 APN 9 20439548 missense possibly damaging 0.68
IGL02273:Zfp26 APN 9 20441448 missense probably damaging 0.96
FR4449:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4548:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4737:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4976:Zfp26 UTSW 9 20438546 missense probably benign 0.01
LCD18:Zfp26 UTSW 9 20438546 missense probably benign 0.01
R1591:Zfp26 UTSW 9 20437625 missense probably benign 0.01
R1818:Zfp26 UTSW 9 20442191 missense probably benign 0.00
R1936:Zfp26 UTSW 9 20437553 missense probably benign 0.04
R2081:Zfp26 UTSW 9 20436617 missense probably benign 0.17
R2107:Zfp26 UTSW 9 20442237 missense probably benign
R2240:Zfp26 UTSW 9 20437267 missense probably damaging 1.00
R3429:Zfp26 UTSW 9 20441460 unclassified probably benign
R3785:Zfp26 UTSW 9 20437802 missense probably damaging 1.00
R4050:Zfp26 UTSW 9 20442229 missense probably benign
R4198:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4200:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4360:Zfp26 UTSW 9 20438573 missense probably benign 0.35
R4505:Zfp26 UTSW 9 20442265 missense probably benign 0.29
R5171:Zfp26 UTSW 9 20444907 missense probably benign
R5412:Zfp26 UTSW 9 20438239 missense possibly damaging 0.75
R5493:Zfp26 UTSW 9 20444319 missense possibly damaging 0.66
R5576:Zfp26 UTSW 9 20437507 missense possibly damaging 0.86
R5652:Zfp26 UTSW 9 20437841 nonsense probably null
R6089:Zfp26 UTSW 9 20437693 missense probably damaging 0.99
R6332:Zfp26 UTSW 9 20437286 missense probably damaging 1.00
R7599:Zfp26 UTSW 9 20437833 missense probably damaging 1.00
R7713:Zfp26 UTSW 9 20441334 missense probably benign 0.08
X0065:Zfp26 UTSW 9 20436891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACATGGATAGGGCCTCTCTCCAG -3'
(R):5'- GGAGTGTGGACAAGCTTCTACTCATC -3'

Sequencing Primer
(F):5'- TCTCCAGTATGTTTCCGTAAGTG -3'
(R):5'- acgagtgtaaggaatgtggg -3'
Posted On2013-04-16