Incidental Mutation 'R2091:Gpr37'
ID231774
Institutional Source Beutler Lab
Gene Symbol Gpr37
Ensembl Gene ENSMUSG00000039904
Gene NameG protein-coupled receptor 37
Synonymsparkin-associated endothelin B-like receptor, Pael-R
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location25665878-25690729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25689063 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 12 (S12P)
Ref Sequence ENSEMBL: ENSMUSP00000144683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054867
AA Change: S12P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: S12P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 536 5.2e-33 PFAM
low complexity region 549 558 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200812
AA Change: S12P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904
AA Change: S12P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 421 3.4e-26 PFAM
Meta Mutation Damage Score 0.2370 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
AC124724.1 T A 19: 47,151,991 D221V probably damaging Het
Adam9 A T 8: 24,995,184 probably benign Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Angpt4 A T 2: 151,936,783 probably benign Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Etnk2 T G 1: 133,377,053 probably null Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gbp7 A T 3: 142,545,555 probably benign Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Hook3 A T 8: 26,059,394 probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pik3cd A G 4: 149,652,699 L880P probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Polh A T 17: 46,181,454 probably benign Het
Prom1 T C 5: 44,014,086 probably benign Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Unc80 T A 1: 66,671,715 probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Gpr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Gpr37 APN 6 25669318 missense possibly damaging 0.65
IGL01595:Gpr37 APN 6 25669573 missense probably damaging 1.00
IGL01670:Gpr37 APN 6 25669834 missense probably damaging 1.00
IGL02552:Gpr37 APN 6 25688687 missense probably benign 0.05
IGL03331:Gpr37 APN 6 25669729 missense probably benign 0.26
R0375:Gpr37 UTSW 6 25669291 missense probably benign 0.08
R0534:Gpr37 UTSW 6 25669824 nonsense probably null
R0892:Gpr37 UTSW 6 25688207 missense probably damaging 1.00
R1481:Gpr37 UTSW 6 25669138 missense probably damaging 0.99
R1700:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R2083:Gpr37 UTSW 6 25688417 missense possibly damaging 0.62
R2089:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2112:Gpr37 UTSW 6 25669381 missense possibly damaging 0.91
R2847:Gpr37 UTSW 6 25666946 unclassified probably benign
R2848:Gpr37 UTSW 6 25666946 unclassified probably benign
R4119:Gpr37 UTSW 6 25688426 missense possibly damaging 0.90
R4611:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R4734:Gpr37 UTSW 6 25689086 missense possibly damaging 0.53
R4765:Gpr37 UTSW 6 25669108 missense probably damaging 1.00
R5163:Gpr37 UTSW 6 25669615 missense possibly damaging 0.87
R5669:Gpr37 UTSW 6 25669352 missense probably benign 0.05
R6548:Gpr37 UTSW 6 25688813 missense probably benign 0.32
R6760:Gpr37 UTSW 6 25669169 missense probably benign 0.00
R7030:Gpr37 UTSW 6 25689005 missense possibly damaging 0.92
R7278:Gpr37 UTSW 6 25669342 missense possibly damaging 0.68
R7392:Gpr37 UTSW 6 25688787 missense probably benign 0.34
R7726:Gpr37 UTSW 6 25669117 missense possibly damaging 0.94
R7754:Gpr37 UTSW 6 25689050 missense probably damaging 0.99
R7757:Gpr37 UTSW 6 25688208 missense probably benign 0.26
V7732:Gpr37 UTSW 6 25669123 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTCTCTGGGCACATGGAC -3'
(R):5'- ATGCTCAGAACATGAAACGTGG -3'

Sequencing Primer
(F):5'- TGGGCACATGGACTCGCAG -3'
(R):5'- GATGACACCGTCCTTCCCCAAG -3'
Posted On2014-09-18