Incidental Mutation 'R8839:Gpr37'
ID 674313
Institutional Source Beutler Lab
Gene Symbol Gpr37
Ensembl Gene ENSMUSG00000039904
Gene Name G protein-coupled receptor 37
Synonyms parkin-associated endothelin B-like receptor, Pael-R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R8839 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 25665878-25690729 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 25669370 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 492 (I492L)
Ref Sequence ENSEMBL: ENSMUSP00000052185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]
AlphaFold Q9QY42
Predicted Effect probably benign
Transcript: ENSMUST00000054867
AA Change: I492L

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: I492L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 536 5.2e-33 PFAM
low complexity region 549 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200812
SMART Domains Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 421 3.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,040 Y325H probably damaging Het
Ace3 T C 11: 105,998,368 Y475H probably damaging Het
Ankfy1 T C 11: 72,730,566 I226T probably benign Het
Anln G A 9: 22,356,172 S825L probably benign Het
B3galt4 A G 17: 33,950,893 S124P possibly damaging Het
Cabin1 T C 10: 75,656,816 I1882V probably benign Het
Caprin2 A T 6: 148,873,027 S262R probably benign Het
Csmd2 A C 4: 128,442,888 I1420L Het
Cyp2b9 T G 7: 26,200,760 V331G probably damaging Het
Cyp3a59 A T 5: 146,109,086 M433L probably benign Het
Edrf1 A G 7: 133,653,915 D597G probably benign Het
Emc3 G A 6: 113,519,970 R147C possibly damaging Het
Fam172a A T 13: 77,999,662 H283L probably benign Het
Fkbp7 T C 2: 76,667,237 probably benign Het
Flii T C 11: 60,718,607 T665A possibly damaging Het
Fxr1 A G 3: 34,046,682 probably benign Het
Hmg20b A C 10: 81,348,915 W108G probably damaging Het
Ighv9-3 G A 12: 114,140,765 T93I possibly damaging Het
Inpp5a T C 7: 139,389,433 V15A probably benign Het
Inpp5d T A 1: 87,691,711 Y376N probably damaging Het
Ints6 A G 14: 62,693,673 F854L probably benign Het
Ipo7 A T 7: 110,042,016 K314N probably damaging Het
Ltn1 C A 16: 87,418,502 C415F probably damaging Het
Mfsd9 T C 1: 40,774,394 T254A probably benign Het
Musk A G 4: 58,286,151 T14A probably benign Het
Ncapd3 T C 9: 27,094,434 V1438A Het
Nnt A T 13: 119,357,637 V636D unknown Het
Olfr1338 A G 4: 118,754,214 L110P probably damaging Het
Olfr629 A G 7: 103,740,814 I142T probably benign Het
Olfr748 A T 14: 50,710,500 T57S possibly damaging Het
Ost4 T C 5: 30,907,591 probably benign Het
Pdzph1 T C 17: 58,950,242 T934A probably benign Het
Plekhn1 T A 4: 156,222,589 probably benign Het
Prkd1 T C 12: 50,342,833 probably benign Het
Ptch1 A T 13: 63,541,224 L413Q probably damaging Het
S100pbp A G 4: 129,182,207 probably null Het
Sec23a T C 12: 58,990,995 K361E possibly damaging Het
Sema3b C T 9: 107,601,353 probably benign Het
Serpina3g A G 12: 104,237,779 probably benign Het
Slc23a2 C T 2: 132,101,472 silent Het
Smug1 T C 15: 103,155,820 R225G possibly damaging Het
Srbd1 T A 17: 85,988,421 I854L probably benign Het
Tbc1d16 G A 11: 119,156,648 R417C probably damaging Het
Tiam1 A G 16: 89,884,939 Y384H probably damaging Het
Trappc9 T A 15: 73,058,238 K90* probably null Het
Tubgcp6 A T 15: 89,103,478 H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,254,556 L72P probably damaging Het
Vmn2r20 A T 6: 123,396,556 H442Q possibly damaging Het
Vmn2r65 A T 7: 84,946,281 Y398* probably null Het
Zfhx4 A G 3: 5,401,855 T2383A probably benign Het
Other mutations in Gpr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Gpr37 APN 6 25669318 missense possibly damaging 0.65
IGL01595:Gpr37 APN 6 25669573 missense probably damaging 1.00
IGL01670:Gpr37 APN 6 25669834 missense probably damaging 1.00
IGL02552:Gpr37 APN 6 25688687 missense probably benign 0.05
IGL03331:Gpr37 APN 6 25669729 missense probably benign 0.26
R0375:Gpr37 UTSW 6 25669291 missense probably benign 0.08
R0534:Gpr37 UTSW 6 25669824 nonsense probably null
R0892:Gpr37 UTSW 6 25688207 missense probably damaging 1.00
R1481:Gpr37 UTSW 6 25669138 missense probably damaging 0.99
R1700:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R2083:Gpr37 UTSW 6 25688417 missense possibly damaging 0.62
R2089:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2112:Gpr37 UTSW 6 25669381 missense possibly damaging 0.91
R2847:Gpr37 UTSW 6 25666946 unclassified probably benign
R2848:Gpr37 UTSW 6 25666946 unclassified probably benign
R4119:Gpr37 UTSW 6 25688426 missense possibly damaging 0.90
R4611:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R4734:Gpr37 UTSW 6 25689086 missense possibly damaging 0.53
R4765:Gpr37 UTSW 6 25669108 missense probably damaging 1.00
R5163:Gpr37 UTSW 6 25669615 missense possibly damaging 0.87
R5669:Gpr37 UTSW 6 25669352 missense probably benign 0.05
R6548:Gpr37 UTSW 6 25688813 missense probably benign 0.32
R6760:Gpr37 UTSW 6 25669169 missense probably benign 0.00
R7030:Gpr37 UTSW 6 25689005 missense possibly damaging 0.92
R7278:Gpr37 UTSW 6 25669342 missense possibly damaging 0.68
R7392:Gpr37 UTSW 6 25688787 missense probably benign 0.34
R7726:Gpr37 UTSW 6 25669117 missense possibly damaging 0.94
R7754:Gpr37 UTSW 6 25689050 missense probably damaging 0.99
R7757:Gpr37 UTSW 6 25688208 missense probably benign 0.26
R8344:Gpr37 UTSW 6 25669531 missense probably damaging 1.00
R8734:Gpr37 UTSW 6 25688202 missense probably benign 0.17
V7732:Gpr37 UTSW 6 25669123 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGTTGTCGTCACTGGTCAC -3'
(R):5'- CCTATGATGGTGCAAGGCTTTG -3'

Sequencing Primer
(F):5'- GTGGAAGACTTCTGGATACACTCC -3'
(R):5'- CAAGGCTTTGGTGGTATTTTGGC -3'
Posted On 2021-07-15