Mutagenetix > Incidental Mutation

Incidental Mutation 'R2134:Adam12'

233633

Institutional Source

Beutler Lab

Gene Symbol

Adam12

Ensembl Gene

ENSMUSG00000054555

Gene Name

a disintegrin and metallopeptidase domain 12 (meltrin alpha)

Synonyms

Mltna, ADAM12

MMRRC Submission

040137-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.393) question?

Stock #

R2134 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

133883199-134232146 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 134012288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 80 (R80*)

Ref Sequence

ENSEMBL: ENSMUSP00000123161 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067680] [ENSMUST00000127524] [ENSMUST00000134504]

AlphaFold

Q61824

Predicted Effect

probably null
Transcript: ENSMUST00000067680
AA Change: R111*

SMART Domains

Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555
AA Change: R111*

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	165	1.1e-27	PFAM
Pfam:Reprolysin_5	210	392	2.1e-24	PFAM
Pfam:Reprolysin_4	210	408	3.8e-16	PFAM
Pfam:Reprolysin	212	414	1.4e-74	PFAM
Pfam:Reprolysin_2	232	404	6e-18	PFAM
Pfam:Reprolysin_3	236	359	1.3e-16	PFAM
DISIN	431	506	4.29e-42	SMART
ACR	507	650	1.75e-67	SMART
transmembrane domain	705	727	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000127524
AA Change: R80*

SMART Domains

Protein: ENSMUSP00000120094
Gene: ENSMUSG00000054555
AA Change: R80*

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	6	135	4.3e-36	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000134504
AA Change: R80*

SMART Domains

Protein: ENSMUSP00000123161
Gene: ENSMUSG00000054555
AA Change: R80*

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	6	135	6.1e-36	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein that localizes to the cell surface. About a third of the mice lacking the encoded protein die before weaning. Overexpression of the encoded protein in a mouse model of Duchenne muscular dystrophy alleviates the muscle pathology by preventing cell necrosis and inflammation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, decreased brown fat, and impaired formation of neck and interscapular muscles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,030,917	V1437E	probably null	Het
Adgrb3	G	T	1: 25,093,957	F479L	probably damaging	Het
Atf7ip	T	A	6: 136,605,487	V1165E	possibly damaging	Het
Atm	C	T	9: 53,467,964		probably null	Het
Atp11c	A	G	X: 60,276,783	Y593H	probably damaging	Het
Btnl1	A	G	17: 34,385,634	D463G	possibly damaging	Het
Cdc34b	T	G	11: 94,742,426	W151G	probably damaging	Het
Cdkal1	A	G	13: 29,354,677	S500P	possibly damaging	Het
Cenpf	T	C	1: 189,658,642	N998D	probably benign	Het
Ces2e	T	A	8: 104,932,539		probably null	Het
Chd7	A	G	4: 8,753,147	Q548R	probably damaging	Het
Chfr	T	A	5: 110,144,761		probably null	Het
Clu	A	G	14: 65,974,841		probably null	Het
Cntnap5c	A	G	17: 58,407,722	D1235G	probably damaging	Het
Col6a4	T	C	9: 106,066,661	S1205G	probably benign	Het
Ddx47	G	T	6: 135,015,350	E113*	probably null	Het
Dock4	A	G	12: 40,745,668	Y828C	probably benign	Het
Dync1h1	T	A	12: 110,656,631	N3553K	possibly damaging	Het
Egflam	C	T	15: 7,234,279	C730Y	probably damaging	Het
Fam83b	T	C	9: 76,491,016	Y935C	probably damaging	Het
Fam83g	A	G	11: 61,703,684	I681M	probably benign	Het
Fastk	T	C	5: 24,445,141	R3G	probably damaging	Het
Fxr1	A	T	3: 34,058,047	E367D	probably damaging	Het
Gatb	A	G	3: 85,611,370	D261G	probably damaging	Het
Gm5617	T	C	9: 48,495,817	S84P	possibly damaging	Het
Gm6614	T	C	6: 141,980,978	I541V	probably damaging	Het
Hecw1	C	T	13: 14,377,700	E104K	probably damaging	Het
Il31ra	T	C	13: 112,543,888	K265R	possibly damaging	Het
Khsrp	GTCATT	GT	17: 57,024,410		probably null	Het
Lrp2	T	A	2: 69,511,067	D923V	probably damaging	Het
Ltn1	A	G	16: 87,382,713	L1520P	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Map1s	T	G	8: 70,913,882	V477G	probably benign	Het
Mical1	T	C	10: 41,482,712	L542P	probably damaging	Het
Mycbp2	T	C	14: 103,208,893	Y1800C	probably damaging	Het
Mylk	A	T	16: 34,986,476	D1697V	probably benign	Het
Nlrp1a	A	T	11: 71,124,188	F79I	probably benign	Het
Olfr653	T	C	7: 104,579,641		probably benign	Het
Pde9a	A	G	17: 31,386,310	Y6C	probably damaging	Het
Plxnd1	A	T	6: 115,957,548	I1808N	probably damaging	Het
Ppp1r13b	T	A	12: 111,833,733	T537S	probably benign	Het
Ppp2r2a	A	G	14: 67,016,475	F415L	possibly damaging	Het
Rabgap1	C	T	2: 37,563,487	R976*	probably null	Het
Rbfox3	T	C	11: 118,497,016	H195R	probably damaging	Het
Ripk4	A	T	16: 97,743,733	D571E	probably damaging	Het
Sdhaf4	T	A	1: 24,005,553	R16S	probably benign	Het
Slc17a1	G	T	13: 23,875,675	G130*	probably null	Het
Slc6a1	G	T	6: 114,302,016	A23S	probably benign	Het
Soga3	T	A	10: 29,196,399	Y562*	probably null	Het
Spock1	T	A	13: 57,436,139	Q321L	probably damaging	Het
Syne2	A	G	12: 75,952,786	I2318V	probably damaging	Het
Terf2ip	T	C	8: 112,011,639	V53A	possibly damaging	Het
Thrb	T	C	14: 18,033,487	F403L	probably benign	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Uqcrfs1	T	C	13: 30,540,804	K251R	probably benign	Het
Vmn2r111	T	C	17: 22,573,104	E57G	possibly damaging	Het
Vmn2r114	T	A	17: 23,291,763	Y581F	probably damaging	Het
Vps13d	A	G	4: 145,148,339	V1866A	probably benign	Het
Washc5	A	T	15: 59,369,234	F84Y	probably damaging	Het
Yars	T	A	4: 129,197,199	Y28*	probably null	Het
Zfp638	A	G	6: 83,928,982	Y43C	probably damaging	Het
Zfp750	T	A	11: 121,513,932	H39L	probably damaging	Het
Zfr2	C	A	10: 81,242,901	S322R	probably damaging	Het
Zzef1	A	G	11: 72,880,624	D1644G	probably benign	Het

Other mutations in Adam12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Adam12	APN	7	133909881	missense	possibly damaging	0.51
IGL01403:Adam12	APN	7	133919610	missense	probably benign	0.00
IGL01482:Adam12	APN	7	133967848	missense	probably damaging	1.00
IGL01922:Adam12	APN	7	133937472	nonsense	probably null
IGL02397:Adam12	APN	7	133909819	splice site	probably benign
IGL03401:Adam12	APN	7	133916463	missense	probably damaging	1.00
R0122:Adam12	UTSW	7	134012348	missense	probably benign	0.45
R0200:Adam12	UTSW	7	133974416	splice site	probably null
R0463:Adam12	UTSW	7	133974416	splice site	probably null
R0927:Adam12	UTSW	7	133998230	missense	probably damaging	1.00
R1258:Adam12	UTSW	7	133937447	missense	probably damaging	1.00
R1440:Adam12	UTSW	7	133931814	missense	probably benign	0.03
R1483:Adam12	UTSW	7	133930025	missense	probably benign	0.41
R1692:Adam12	UTSW	7	133887944	makesense	probably null
R1797:Adam12	UTSW	7	133967861	missense	probably benign	0.03
R2230:Adam12	UTSW	7	133919618	missense	probably damaging	1.00
R2350:Adam12	UTSW	7	133919524	missense	probably damaging	1.00
R2944:Adam12	UTSW	7	133975507	missense	probably null	0.02
R3688:Adam12	UTSW	7	133964796	nonsense	probably null
R3747:Adam12	UTSW	7	134172865	missense	probably damaging	0.96
R3749:Adam12	UTSW	7	134172865	missense	probably damaging	0.96
R3750:Adam12	UTSW	7	134172865	missense	probably damaging	0.96
R4028:Adam12	UTSW	7	133929996	missense	probably damaging	1.00
R4130:Adam12	UTSW	7	133912924	missense	probably damaging	1.00
R4131:Adam12	UTSW	7	133912924	missense	probably damaging	1.00
R4346:Adam12	UTSW	7	133981535	missense	possibly damaging	0.82
R4701:Adam12	UTSW	7	133916462	missense	possibly damaging	0.64
R4887:Adam12	UTSW	7	134172821	missense	possibly damaging	0.74
R5355:Adam12	UTSW	7	133887942	makesense	probably null
R5468:Adam12	UTSW	7	133975473	missense	probably damaging	1.00
R5486:Adam12	UTSW	7	133907672	missense	possibly damaging	0.75
R5990:Adam12	UTSW	7	133931736	missense	probably damaging	1.00
R6504:Adam12	UTSW	7	133929984	missense	probably damaging	1.00
R6783:Adam12	UTSW	7	133974397	missense	probably damaging	1.00
R7117:Adam12	UTSW	7	133916462	missense	probably benign	0.00
R7263:Adam12	UTSW	7	133919511	missense	possibly damaging	0.68
R7749:Adam12	UTSW	7	134224813	missense	unknown
R7820:Adam12	UTSW	7	133998188	missense	probably benign	0.00
R7880:Adam12	UTSW	7	133909962	missense	possibly damaging	0.94
R7891:Adam12	UTSW	7	133998232	missense	probably benign	0.00
R8114:Adam12	UTSW	7	133967888	missense	probably damaging	1.00
R8160:Adam12	UTSW	7	133968041	splice site	probably null
R8683:Adam12	UTSW	7	133890200	missense	possibly damaging	0.49
R9236:Adam12	UTSW	7	134012293	missense	probably benign	0.03
R9277:Adam12	UTSW	7	133919832	missense	probably benign	0.00
R9480:Adam12	UTSW	7	134134741	missense	probably damaging	0.98
R9515:Adam12	UTSW	7	133907644	missense	probably benign	0.03
R9599:Adam12	UTSW	7	133964725	missense	probably damaging	0.99
X0057:Adam12	UTSW	7	134012315	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAACCTCGGTGATCCTCCTG -3'
(R):5'- GCCCTCTAAATTCTCCCTGGAAAC -3'

Sequencing Primer
(F):5'- GGTGATCCTCCTGTCTCAGC -3'
(R):5'- CCTGAATAGGTGAAGCCCTTTGC -3'

Posted On

2014-10-01