Incidental Mutation 'R2145:Dvl1'
ID233714
Institutional Source Beutler Lab
Gene Symbol Dvl1
Ensembl Gene ENSMUSG00000029071
Gene Namedishevelled segment polarity protein 1
Synonyms
MMRRC Submission 040148-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2145 (G1)
Quality Score122
Status Validated
Chromosome4
Chromosomal Location155847402-155859303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155847816 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 28 (V28I)
Ref Sequence ENSEMBL: ENSMUSP00000133137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030947] [ENSMUST00000030948] [ENSMUST00000168552]
Predicted Effect probably benign
Transcript: ENSMUST00000030947
SMART Domains Protein: ENSMUSP00000030947
Gene: ENSMUSG00000029070

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 38 156 6.16e-4 SMART
IG 170 291 9.71e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
low complexity region 371 384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000030948
AA Change: V28I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071
AA Change: V28I

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect possibly damaging
Transcript: ENSMUST00000168552
AA Change: V28I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071
AA Change: V28I

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Dishevelled family of proteins. These proteins have an N-terminal Dishevelled/Axin domain, a Dishevelled, EGL-10, Plextrin domain, a central PDZ domain, and a C-terminal domain of approximately 200 amino acids. They regulate both canonical and non-canonical Wnt signaling as well as planar cell polarity pathways. Mice deficient for this gene are viable and fertile but display reduced social interaction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are viable and fertile, but show a number of behavioral changes including deficient nest-building, less huddling contact during sleep, reduced subordinate responses, and other social interaction deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,874 Y32C probably damaging Het
Abca15 A G 7: 120,354,478 N535S probably benign Het
Abcc6 A T 7: 45,998,741 L717Q probably benign Het
Abraxas2 C A 7: 132,883,061 Q278K probably benign Het
Acap2 A T 16: 31,105,524 D637E probably benign Het
AI661453 A G 17: 47,466,098 probably benign Het
Aoah A T 13: 20,840,096 E74V probably damaging Het
Appl1 A G 14: 26,949,619 L292S possibly damaging Het
Astl T A 2: 127,347,189 V166E probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bbs1 T G 19: 4,903,707 K143Q possibly damaging Het
Bbx T C 16: 50,274,544 probably benign Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
C1qtnf2 T G 11: 43,490,984 F178V probably damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Clcn7 A G 17: 25,144,451 I34V probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Des C A 1: 75,363,464 probably benign Het
Dgcr8 A T 16: 18,280,230 D432E probably benign Het
Dlgap5 G A 14: 47,395,923 R549* probably null Het
Dmxl2 T C 9: 54,415,910 T1397A probably damaging Het
Dnmt1 T A 9: 20,937,155 probably benign Het
Doxl2 A T 6: 48,976,695 D518V probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dtwd1 C A 2: 126,159,984 T208N probably damaging Het
Dync1i2 T A 2: 71,214,563 probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Fmod T C 1: 134,040,518 Y99H probably benign Het
Fn1 A T 1: 71,606,004 V1552D probably damaging Het
Fnip2 A T 3: 79,500,432 S281T probably damaging Het
Glb1 A G 9: 114,464,165 H536R probably benign Het
Glis2 T A 16: 4,613,642 S344R possibly damaging Het
Gm1966 T A 7: 106,603,008 H343L possibly damaging Het
Gm4847 A T 1: 166,634,903 S339R probably benign Het
Gpr155 A G 2: 73,356,658 S44P probably benign Het
Gprin1 G A 13: 54,738,632 P610S probably damaging Het
H2-Ob A T 17: 34,242,580 M98L probably benign Het
Hist1h3e T C 13: 23,562,356 T4A probably benign Het
Hmcn2 T C 2: 31,333,931 probably benign Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Il13 T C 11: 53,632,524 T85A possibly damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Irgm2 T C 11: 58,220,529 S361P possibly damaging Het
Itga11 C T 9: 62,732,204 probably benign Het
Kalrn G T 16: 34,009,262 probably benign Het
Kcng1 C A 2: 168,269,032 G71C probably damaging Het
Kcnq5 T A 1: 21,505,349 D291V probably damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lhx6 C T 2: 36,087,466 V325I probably benign Het
Lipc A G 9: 70,934,535 I9T possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mast1 C A 8: 84,921,478 G458V probably damaging Het
Mga T C 2: 119,964,157 V2565A possibly damaging Het
Mkl2 T C 16: 13,412,586 I1045T probably damaging Het
Mpzl2 C G 9: 45,044,173 D127E probably benign Het
Myh3 T A 11: 67,091,056 C793S probably benign Het
Nomo1 T C 7: 46,066,504 L765P probably damaging Het
Nup210 A G 6: 91,028,876 I1335T possibly damaging Het
Olfr549 T C 7: 102,555,060 probably null Het
Oxr1 T A 15: 41,819,944 S254R probably damaging Het
Pan3 A G 5: 147,530,098 I592V possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pex2 T C 3: 5,561,590 E53G probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Phactr4 T C 4: 132,370,784 E391G probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Pkhd1l1 A T 15: 44,512,877 probably null Het
Pnlip A G 19: 58,676,444 S235G probably benign Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptprc T C 1: 138,073,681 Y780C probably damaging Het
Pxn T A 5: 115,552,756 probably benign Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rc3h1 G T 1: 160,930,257 K48N probably damaging Het
Rfwd3 T C 8: 111,282,613 I444V probably benign Het
Rictor C T 15: 6,765,107 R293C probably damaging Het
Rif1 T A 2: 52,111,400 I1622N possibly damaging Het
Rnf213 T C 11: 119,415,193 V609A probably benign Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Serac1 A T 17: 6,050,785 I448N probably damaging Het
Sh3kbp1 C A X: 159,824,496 T200K probably benign Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Socs7 T C 11: 97,373,124 F281L probably benign Het
Spta1 C T 1: 174,212,614 L1214F probably benign Het
Ssu72 A G 4: 155,705,443 E21G probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tmem130 C A 5: 144,743,785 V270L probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Tspyl2 A T X: 152,338,894 D572E probably benign Het
Unc45b G A 11: 82,917,754 R222H probably benign Het
Uxs1 T C 1: 43,827,623 Y29C probably damaging Het
Virma T A 4: 11,548,726 probably benign Het
Vmn1r202 C T 13: 22,501,783 G155S possibly damaging Het
Vmn2r24 T A 6: 123,779,013 F15I probably benign Het
Wdr64 A G 1: 175,767,095 T471A probably benign Het
Zfa-ps T A 10: 52,543,277 noncoding transcript Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Zfp934 T C 13: 62,517,834 D331G probably damaging Het
Zscan29 T C 2: 121,170,106 R7G probably damaging Het
Other mutations in Dvl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Dvl1 APN 4 155853698 missense possibly damaging 0.85
IGL01930:Dvl1 APN 4 155856188 missense possibly damaging 0.72
IGL02499:Dvl1 APN 4 155854780 missense probably benign 0.10
IGL03075:Dvl1 APN 4 155854583 missense probably damaging 0.99
IGL03089:Dvl1 APN 4 155855152 missense probably damaging 1.00
R0525:Dvl1 UTSW 4 155855595 missense probably damaging 0.99
R0624:Dvl1 UTSW 4 155854775 missense probably damaging 1.00
R0633:Dvl1 UTSW 4 155858295 missense probably damaging 1.00
R1459:Dvl1 UTSW 4 155854019 missense probably damaging 0.99
R1955:Dvl1 UTSW 4 155858029 missense possibly damaging 0.69
R1991:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2144:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2156:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2191:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2192:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2290:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2292:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2304:Dvl1 UTSW 4 155855584 missense probably damaging 0.98
R2519:Dvl1 UTSW 4 155855543 nonsense probably null
R3082:Dvl1 UTSW 4 155847859 missense possibly damaging 0.92
R3110:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R3112:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R4775:Dvl1 UTSW 4 155858127 missense probably benign
R5384:Dvl1 UTSW 4 155853686 missense probably damaging 0.99
R6148:Dvl1 UTSW 4 155854952 missense probably damaging 1.00
R6563:Dvl1 UTSW 4 155856253 missense probably damaging 1.00
R7293:Dvl1 UTSW 4 155856168 missense possibly damaging 0.93
R7746:Dvl1 UTSW 4 155856239 missense possibly damaging 0.93
Z1176:Dvl1 UTSW 4 155855611 missense probably benign 0.04
Z1177:Dvl1 UTSW 4 155847637 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTCGTGAACAGCCCGAGG -3'
(R):5'- CACCTGCTGTAGATGCGCAG -3'

Sequencing Primer
(F):5'- TCAGAGCCGCTTTCCCTGG -3'
(R):5'- TCTGACGTCCCCAGACC -3'
Posted On2014-10-01