Incidental Mutation 'R2145:Phactr4'
ID233712
Institutional Source Beutler Lab
Gene Symbol Phactr4
Ensembl Gene ENSMUSG00000066043
Gene Namephosphatase and actin regulator 4
Synonyms3110001B12Rik, C330013F19Rik
MMRRC Submission 040148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2145 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132355923-132422489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132370784 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 391 (E391G)
Ref Sequence ENSEMBL: ENSMUSP00000081270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084170] [ENSMUST00000084249] [ENSMUST00000102568] [ENSMUST00000152271]
Predicted Effect probably damaging
Transcript: ENSMUST00000084170
AA Change: E354G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081185
Gene: ENSMUSG00000066043
AA Change: E354G

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 488 497 N/A INTRINSIC
Blast:RPEL 511 535 8e-7 BLAST
RPEL 548 573 2.53e-8 SMART
RPEL 586 611 2.17e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084249
AA Change: E391G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081270
Gene: ENSMUSG00000066043
AA Change: E391G

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
RPEL 73 98 1.35e-3 SMART
low complexity region 125 140 N/A INTRINSIC
low complexity region 172 186 N/A INTRINSIC
low complexity region 194 219 N/A INTRINSIC
low complexity region 231 270 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 335 359 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 525 534 N/A INTRINSIC
Blast:RPEL 548 572 9e-7 BLAST
RPEL 585 610 2.53e-8 SMART
RPEL 623 648 2.17e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102568
AA Change: E381G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099628
Gene: ENSMUSG00000066043
AA Change: E381G

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
RPEL 63 88 1.35e-3 SMART
low complexity region 115 130 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
low complexity region 184 209 N/A INTRINSIC
low complexity region 221 260 N/A INTRINSIC
low complexity region 281 291 N/A INTRINSIC
low complexity region 325 349 N/A INTRINSIC
low complexity region 498 508 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
Blast:RPEL 538 562 9e-7 BLAST
RPEL 575 600 2.53e-8 SMART
RPEL 613 638 2.17e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127516
Predicted Effect probably benign
Transcript: ENSMUST00000152271
SMART Domains Protein: ENSMUSP00000119767
Gene: ENSMUSG00000066043

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
Meta Mutation Damage Score 0.0642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator (PHACTR) family. Other PHACTR family members have been shown to inhibit protein phosphatase 1 (PP1) activity, and the homolog of this gene in the mouse has been shown to interact with actin and PP1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality, exencephaly, neural tube defects, coloboma, and altered cell cycles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,874 Y32C probably damaging Het
Abca15 A G 7: 120,354,478 N535S probably benign Het
Abcc6 A T 7: 45,998,741 L717Q probably benign Het
Abraxas2 C A 7: 132,883,061 Q278K probably benign Het
Acap2 A T 16: 31,105,524 D637E probably benign Het
AI661453 A G 17: 47,466,098 probably benign Het
Aoah A T 13: 20,840,096 E74V probably damaging Het
Appl1 A G 14: 26,949,619 L292S possibly damaging Het
Astl T A 2: 127,347,189 V166E probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bbs1 T G 19: 4,903,707 K143Q possibly damaging Het
Bbx T C 16: 50,274,544 probably benign Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
C1qtnf2 T G 11: 43,490,984 F178V probably damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Clcn7 A G 17: 25,144,451 I34V probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Des C A 1: 75,363,464 probably benign Het
Dgcr8 A T 16: 18,280,230 D432E probably benign Het
Dlgap5 G A 14: 47,395,923 R549* probably null Het
Dmxl2 T C 9: 54,415,910 T1397A probably damaging Het
Dnmt1 T A 9: 20,937,155 probably benign Het
Doxl2 A T 6: 48,976,695 D518V probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dtwd1 C A 2: 126,159,984 T208N probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dync1i2 T A 2: 71,214,563 probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Fmod T C 1: 134,040,518 Y99H probably benign Het
Fn1 A T 1: 71,606,004 V1552D probably damaging Het
Fnip2 A T 3: 79,500,432 S281T probably damaging Het
Glb1 A G 9: 114,464,165 H536R probably benign Het
Glis2 T A 16: 4,613,642 S344R possibly damaging Het
Gm1966 T A 7: 106,603,008 H343L possibly damaging Het
Gm4847 A T 1: 166,634,903 S339R probably benign Het
Gpr155 A G 2: 73,356,658 S44P probably benign Het
Gprin1 G A 13: 54,738,632 P610S probably damaging Het
H2-Ob A T 17: 34,242,580 M98L probably benign Het
Hist1h3e T C 13: 23,562,356 T4A probably benign Het
Hmcn2 T C 2: 31,333,931 probably benign Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Il13 T C 11: 53,632,524 T85A possibly damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Irgm2 T C 11: 58,220,529 S361P possibly damaging Het
Itga11 C T 9: 62,732,204 probably benign Het
Kalrn G T 16: 34,009,262 probably benign Het
Kcng1 C A 2: 168,269,032 G71C probably damaging Het
Kcnq5 T A 1: 21,505,349 D291V probably damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lhx6 C T 2: 36,087,466 V325I probably benign Het
Lipc A G 9: 70,934,535 I9T possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mast1 C A 8: 84,921,478 G458V probably damaging Het
Mga T C 2: 119,964,157 V2565A possibly damaging Het
Mkl2 T C 16: 13,412,586 I1045T probably damaging Het
Mpzl2 C G 9: 45,044,173 D127E probably benign Het
Myh3 T A 11: 67,091,056 C793S probably benign Het
Nomo1 T C 7: 46,066,504 L765P probably damaging Het
Nup210 A G 6: 91,028,876 I1335T possibly damaging Het
Olfr549 T C 7: 102,555,060 probably null Het
Oxr1 T A 15: 41,819,944 S254R probably damaging Het
Pan3 A G 5: 147,530,098 I592V possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pex2 T C 3: 5,561,590 E53G probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Pkhd1l1 A T 15: 44,512,877 probably null Het
Pnlip A G 19: 58,676,444 S235G probably benign Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptprc T C 1: 138,073,681 Y780C probably damaging Het
Pxn T A 5: 115,552,756 probably benign Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rc3h1 G T 1: 160,930,257 K48N probably damaging Het
Rfwd3 T C 8: 111,282,613 I444V probably benign Het
Rictor C T 15: 6,765,107 R293C probably damaging Het
Rif1 T A 2: 52,111,400 I1622N possibly damaging Het
Rnf213 T C 11: 119,415,193 V609A probably benign Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Serac1 A T 17: 6,050,785 I448N probably damaging Het
Sh3kbp1 C A X: 159,824,496 T200K probably benign Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Socs7 T C 11: 97,373,124 F281L probably benign Het
Spta1 C T 1: 174,212,614 L1214F probably benign Het
Ssu72 A G 4: 155,705,443 E21G probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tmem130 C A 5: 144,743,785 V270L probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Tspyl2 A T X: 152,338,894 D572E probably benign Het
Unc45b G A 11: 82,917,754 R222H probably benign Het
Uxs1 T C 1: 43,827,623 Y29C probably damaging Het
Virma T A 4: 11,548,726 probably benign Het
Vmn1r202 C T 13: 22,501,783 G155S possibly damaging Het
Vmn2r24 T A 6: 123,779,013 F15I probably benign Het
Wdr64 A G 1: 175,767,095 T471A probably benign Het
Zfa-ps T A 10: 52,543,277 noncoding transcript Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Zfp934 T C 13: 62,517,834 D331G probably damaging Het
Zscan29 T C 2: 121,170,106 R7G probably damaging Het
Other mutations in Phactr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Phactr4 APN 4 132370992 missense possibly damaging 0.94
IGL01106:Phactr4 APN 4 132370805 missense probably benign 0.09
IGL01962:Phactr4 APN 4 132363775 missense probably damaging 0.99
IGL02382:Phactr4 APN 4 132370841 missense probably damaging 1.00
IGL02466:Phactr4 APN 4 132377172 splice site probably benign
IGL02891:Phactr4 APN 4 132387023 missense probably damaging 1.00
P0027:Phactr4 UTSW 4 132371090 missense probably damaging 1.00
R0317:Phactr4 UTSW 4 132386930 missense probably damaging 1.00
R0961:Phactr4 UTSW 4 132378420 missense probably benign
R1435:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1441:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1443:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1960:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1961:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R3077:Phactr4 UTSW 4 132397996 start codon destroyed probably null 0.53
R3423:Phactr4 UTSW 4 132369747 missense probably benign 0.38
R3782:Phactr4 UTSW 4 132367867 unclassified probably null
R3871:Phactr4 UTSW 4 132377249 missense probably benign 0.00
R4427:Phactr4 UTSW 4 132387041 missense possibly damaging 0.90
R4672:Phactr4 UTSW 4 132370706 missense probably damaging 1.00
R4871:Phactr4 UTSW 4 132378448 missense probably damaging 1.00
R5264:Phactr4 UTSW 4 132370982 missense probably damaging 0.99
R5558:Phactr4 UTSW 4 132378455 missense probably damaging 1.00
R5955:Phactr4 UTSW 4 132386909 missense probably damaging 1.00
R6953:Phactr4 UTSW 4 132377351 missense possibly damaging 0.66
R7210:Phactr4 UTSW 4 132358271 makesense probably null
R7286:Phactr4 UTSW 4 132377178 critical splice donor site probably null
R7823:Phactr4 UTSW 4 132361619 nonsense probably null
R7826:Phactr4 UTSW 4 132378441 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCAGTGAATGGGCTCTGTG -3'
(R):5'- GCTGCTTCGTTCACAACTAAG -3'

Sequencing Primer
(F):5'- GCTCTGTGAGTGCCTTCCAAG -3'
(R):5'- TGCTTCGTTCACAACTAAGACAGC -3'
Posted On2014-10-01