Incidental Mutation 'R2145:Rap1gap2'
ID233755
Institutional Source Beutler Lab
Gene Symbol Rap1gap2
Ensembl Gene ENSMUSG00000038807
Gene NameRAP1 GTPase activating protein 2
SynonymsGarnl4, LOC380710
MMRRC Submission 040148-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R2145 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74383356-74610915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74425976 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 245 (T245M)
Ref Sequence ENSEMBL: ENSMUSP00000040180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047488] [ENSMUST00000102521]
Predicted Effect probably damaging
Transcript: ENSMUST00000047488
AA Change: T245M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040180
Gene: ENSMUSG00000038807
AA Change: T245M

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 445 1.2e-64 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102521
AA Change: T185M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099580
Gene: ENSMUSG00000038807
AA Change: T185M

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 439 4.9e-67 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Meta Mutation Damage Score 0.0952 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein that activates the small guanine-nucleotide-binding protein Rap1 in platelets. The protein interacts with synaptotagmin-like protein 1 and Rab27 and regulates secretion of dense granules from platelets at sites of endothelial damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,874 Y32C probably damaging Het
Abca15 A G 7: 120,354,478 N535S probably benign Het
Abcc6 A T 7: 45,998,741 L717Q probably benign Het
Abraxas2 C A 7: 132,883,061 Q278K probably benign Het
Acap2 A T 16: 31,105,524 D637E probably benign Het
AI661453 A G 17: 47,466,098 probably benign Het
Aoah A T 13: 20,840,096 E74V probably damaging Het
Appl1 A G 14: 26,949,619 L292S possibly damaging Het
Astl T A 2: 127,347,189 V166E probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bbs1 T G 19: 4,903,707 K143Q possibly damaging Het
Bbx T C 16: 50,274,544 probably benign Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
C1qtnf2 T G 11: 43,490,984 F178V probably damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Clcn7 A G 17: 25,144,451 I34V probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Des C A 1: 75,363,464 probably benign Het
Dgcr8 A T 16: 18,280,230 D432E probably benign Het
Dlgap5 G A 14: 47,395,923 R549* probably null Het
Dmxl2 T C 9: 54,415,910 T1397A probably damaging Het
Dnmt1 T A 9: 20,937,155 probably benign Het
Doxl2 A T 6: 48,976,695 D518V probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dtwd1 C A 2: 126,159,984 T208N probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dync1i2 T A 2: 71,214,563 probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Fmod T C 1: 134,040,518 Y99H probably benign Het
Fn1 A T 1: 71,606,004 V1552D probably damaging Het
Fnip2 A T 3: 79,500,432 S281T probably damaging Het
Glb1 A G 9: 114,464,165 H536R probably benign Het
Glis2 T A 16: 4,613,642 S344R possibly damaging Het
Gm1966 T A 7: 106,603,008 H343L possibly damaging Het
Gm4847 A T 1: 166,634,903 S339R probably benign Het
Gpr155 A G 2: 73,356,658 S44P probably benign Het
Gprin1 G A 13: 54,738,632 P610S probably damaging Het
H2-Ob A T 17: 34,242,580 M98L probably benign Het
Hist1h3e T C 13: 23,562,356 T4A probably benign Het
Hmcn2 T C 2: 31,333,931 probably benign Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Il13 T C 11: 53,632,524 T85A possibly damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Irgm2 T C 11: 58,220,529 S361P possibly damaging Het
Itga11 C T 9: 62,732,204 probably benign Het
Kalrn G T 16: 34,009,262 probably benign Het
Kcng1 C A 2: 168,269,032 G71C probably damaging Het
Kcnq5 T A 1: 21,505,349 D291V probably damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lhx6 C T 2: 36,087,466 V325I probably benign Het
Lipc A G 9: 70,934,535 I9T possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mast1 C A 8: 84,921,478 G458V probably damaging Het
Mga T C 2: 119,964,157 V2565A possibly damaging Het
Mkl2 T C 16: 13,412,586 I1045T probably damaging Het
Mpzl2 C G 9: 45,044,173 D127E probably benign Het
Myh3 T A 11: 67,091,056 C793S probably benign Het
Nomo1 T C 7: 46,066,504 L765P probably damaging Het
Nup210 A G 6: 91,028,876 I1335T possibly damaging Het
Olfr549 T C 7: 102,555,060 probably null Het
Oxr1 T A 15: 41,819,944 S254R probably damaging Het
Pan3 A G 5: 147,530,098 I592V possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pex2 T C 3: 5,561,590 E53G probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Phactr4 T C 4: 132,370,784 E391G probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Pkhd1l1 A T 15: 44,512,877 probably null Het
Pnlip A G 19: 58,676,444 S235G probably benign Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptprc T C 1: 138,073,681 Y780C probably damaging Het
Pxn T A 5: 115,552,756 probably benign Het
Rc3h1 G T 1: 160,930,257 K48N probably damaging Het
Rfwd3 T C 8: 111,282,613 I444V probably benign Het
Rictor C T 15: 6,765,107 R293C probably damaging Het
Rif1 T A 2: 52,111,400 I1622N possibly damaging Het
Rnf213 T C 11: 119,415,193 V609A probably benign Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Serac1 A T 17: 6,050,785 I448N probably damaging Het
Sh3kbp1 C A X: 159,824,496 T200K probably benign Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Socs7 T C 11: 97,373,124 F281L probably benign Het
Spta1 C T 1: 174,212,614 L1214F probably benign Het
Ssu72 A G 4: 155,705,443 E21G probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tmem130 C A 5: 144,743,785 V270L probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Tspyl2 A T X: 152,338,894 D572E probably benign Het
Unc45b G A 11: 82,917,754 R222H probably benign Het
Uxs1 T C 1: 43,827,623 Y29C probably damaging Het
Virma T A 4: 11,548,726 probably benign Het
Vmn1r202 C T 13: 22,501,783 G155S possibly damaging Het
Vmn2r24 T A 6: 123,779,013 F15I probably benign Het
Wdr64 A G 1: 175,767,095 T471A probably benign Het
Zfa-ps T A 10: 52,543,277 noncoding transcript Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Zfp934 T C 13: 62,517,834 D331G probably damaging Het
Zscan29 T C 2: 121,170,106 R7G probably damaging Het
Other mutations in Rap1gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Rap1gap2 APN 11 74416259 missense probably benign 0.25
IGL00839:Rap1gap2 APN 11 74437448 missense probably damaging 1.00
IGL02301:Rap1gap2 APN 11 74407369 missense probably damaging 1.00
IGL02367:Rap1gap2 APN 11 74397355 critical splice donor site probably null
IGL02832:Rap1gap2 APN 11 74412455 splice site probably benign
IGL03067:Rap1gap2 APN 11 74393412 missense possibly damaging 0.63
IGL03341:Rap1gap2 APN 11 74435714 missense probably damaging 1.00
IGL03355:Rap1gap2 APN 11 74412344 missense probably damaging 1.00
P0026:Rap1gap2 UTSW 11 74567210 splice site probably benign
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0514:Rap1gap2 UTSW 11 74388854 missense possibly damaging 0.74
R0518:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R0521:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R1070:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1998:Rap1gap2 UTSW 11 74395833 missense probably benign 0.04
R2144:Rap1gap2 UTSW 11 74425976 missense probably damaging 1.00
R2180:Rap1gap2 UTSW 11 74393146 missense probably benign 0.24
R2938:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2991:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2992:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2993:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3033:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3035:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3686:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4426:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4427:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4621:Rap1gap2 UTSW 11 74435699 critical splice donor site probably null
R4705:Rap1gap2 UTSW 11 74437439 missense probably damaging 1.00
R4809:Rap1gap2 UTSW 11 74407974 splice site probably benign
R5092:Rap1gap2 UTSW 11 74438295 missense probably damaging 1.00
R5283:Rap1gap2 UTSW 11 74395825 missense probably damaging 1.00
R5343:Rap1gap2 UTSW 11 74441785 missense probably damaging 0.99
R5941:Rap1gap2 UTSW 11 74392237 missense probably damaging 1.00
R6414:Rap1gap2 UTSW 11 74405790 missense probably damaging 1.00
R6647:Rap1gap2 UTSW 11 74407928 missense probably benign 0.04
R6951:Rap1gap2 UTSW 11 74484948 missense possibly damaging 0.81
R7096:Rap1gap2 UTSW 11 74392231 missense probably damaging 0.99
R7107:Rap1gap2 UTSW 11 74393119 missense probably damaging 1.00
R7397:Rap1gap2 UTSW 11 74414411 missense probably benign 0.28
R7553:Rap1gap2 UTSW 11 74435722 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGCTAAGAGCCATCTCACC -3'
(R):5'- TGGTGCACACAGTAAGGAGTTC -3'

Sequencing Primer
(F):5'- GAGCCATCTCACCCCATCTAGG -3'
(R):5'- GCACACAGTAAGGAGTTCATTTTCTC -3'
Posted On2014-10-01