Incidental Mutation 'R7521:Dtx4'
ID 582689
Institutional Source Beutler Lab
Gene Symbol Dtx4
Ensembl Gene ENSMUSG00000039982
Gene Name deltex 4, E3 ubiquitin ligase
Synonyms RNF155
MMRRC Submission
Accession Numbers

Genbank: NM_001047855

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R7521 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 12466341-12501996 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12492497 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 89 (K89E)
Ref Sequence ENSEMBL: ENSMUSP00000040229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521]
AlphaFold Q6PDK8
Predicted Effect probably benign
Transcript: ENSMUST00000045521
AA Change: K89E

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982
AA Change: K89E

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 A G 17: 31,064,569 N76S probably benign Het
Ahnak T C 19: 9,002,351 V333A possibly damaging Het
Arid1b GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 17: 4,995,844 probably benign Het
Arid1b GGCGGC GGCGGCAGCGGC 17: 4,995,860 probably benign Het
Arid1b A G 17: 5,342,590 T2079A probably benign Het
Clca3a2 A G 3: 144,801,913 *190R probably null Het
Cntnap3 G T 13: 64,772,001 Q681K probably benign Het
Coro7 T C 16: 4,631,482 D689G probably benign Het
Dnah9 A T 11: 65,989,837 S2645T probably damaging Het
Dnm3 A T 1: 162,134,544 L32H probably damaging Het
Exph5 T A 9: 53,374,077 N819K possibly damaging Het
Fpgt A G 3: 155,087,128 S421P possibly damaging Het
Gbp5 T C 3: 142,500,621 V22A probably benign Het
Gpatch1 C T 7: 35,293,788 R544Q probably damaging Het
Grm5 T A 7: 88,074,272 L590Q possibly damaging Het
Hc T C 2: 35,045,332 D172G possibly damaging Het
Ifi209 A T 1: 173,642,695 N283I probably damaging Het
Igsf11 C T 16: 39,008,912 T115M probably damaging Het
Il17rd T A 14: 27,094,866 M320K probably benign Het
Kdm5a T A 6: 120,432,187 C1610* probably null Het
Mast3 T A 8: 70,788,768 I175L probably benign Het
Mif A T 10: 75,860,108 S21T possibly damaging Het
Mindy2 T C 9: 70,607,510 Q542R probably benign Het
Nalcn T A 14: 123,293,458 E1389D probably damaging Het
Olfr1101 T A 2: 86,988,610 T189S probably damaging Het
Olfr175-ps1 T C 16: 58,823,894 I272V probably benign Het
Olfr543 C T 7: 102,477,195 R225H possibly damaging Het
Olfr873 T C 9: 20,300,740 I181T probably benign Het
Pcsk5 T A 19: 17,454,832 D1473V probably benign Het
Phax C T 18: 56,575,918 Q185* probably null Het
Ppp2r2b T A 18: 43,059,177 S22C probably benign Het
Prss40 A G 1: 34,558,009 F153L probably benign Het
Slc22a2 T C 17: 12,586,823 S154P probably benign Het
Speer4a G A 5: 26,036,765 T121I probably damaging Het
Tacc1 A G 8: 25,175,252 V488A possibly damaging Het
Tdrp G A 8: 13,953,831 Q169* probably null Het
Tmem30b C T 12: 73,545,318 R341H probably benign Het
Other mutations in Dtx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Dtx4 APN 19 12478215 missense possibly damaging 0.88
IGL02173:Dtx4 APN 19 12473257 nonsense probably null
IGL03127:Dtx4 APN 19 12486500 splice site probably benign
G5030:Dtx4 UTSW 19 12469579 missense probably benign 0.07
R0143:Dtx4 UTSW 19 12486482 missense probably damaging 0.98
R0932:Dtx4 UTSW 19 12492151 missense probably benign
R1066:Dtx4 UTSW 19 12501009 missense probably damaging 0.98
R2155:Dtx4 UTSW 19 12485282 nonsense probably null
R2182:Dtx4 UTSW 19 12483107 missense probably null 0.75
R2362:Dtx4 UTSW 19 12492535 missense probably damaging 1.00
R3880:Dtx4 UTSW 19 12486456 missense probably benign 0.01
R4108:Dtx4 UTSW 19 12501123 missense probably damaging 0.96
R4361:Dtx4 UTSW 19 12485296 missense probably benign 0.04
R4943:Dtx4 UTSW 19 12501060 missense probably damaging 1.00
R5361:Dtx4 UTSW 19 12485262 critical splice donor site probably null
R5440:Dtx4 UTSW 19 12492317 missense probably damaging 1.00
R5613:Dtx4 UTSW 19 12485403 missense probably damaging 0.97
R5614:Dtx4 UTSW 19 12482183 missense probably damaging 1.00
R5703:Dtx4 UTSW 19 12482210 missense possibly damaging 0.84
R5994:Dtx4 UTSW 19 12501153 missense probably damaging 1.00
R6695:Dtx4 UTSW 19 12473235 nonsense probably null
R7107:Dtx4 UTSW 19 12473260 nonsense probably null
R7208:Dtx4 UTSW 19 12482073 critical splice donor site probably null
R7231:Dtx4 UTSW 19 12469658 nonsense probably null
R7609:Dtx4 UTSW 19 12492281 missense probably damaging 1.00
R7721:Dtx4 UTSW 19 12482136 missense probably benign 0.09
R7775:Dtx4 UTSW 19 12492010 missense probably benign 0.02
R8685:Dtx4 UTSW 19 12469631 missense probably benign 0.36
Z1176:Dtx4 UTSW 19 12491909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATGGGGTAGATGAGGTCTAG -3'
(R):5'- ACACACTACTAGGCAGCATAGG -3'

Sequencing Primer
(F):5'- AGGTCTAGTCGTCGTCTGACAC -3'
(R):5'- ATAGGGCCTGCCACACAGTAG -3'
Posted On 2019-10-17