Incidental Mutation 'R2234:Tmprss11c'
ID239913
Institutional Source Beutler Lab
Gene Symbol Tmprss11c
Ensembl Gene ENSMUSG00000061184
Gene Nametransmembrane protease, serine 11c
Synonyms
MMRRC Submission 040235-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2234 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86231481-86289308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86282086 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 40 (T40K)
Ref Sequence ENSEMBL: ENSMUSP00000142902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059424] [ENSMUST00000196462]
Predicted Effect probably benign
Transcript: ENSMUST00000059424
AA Change: T40K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062915
Gene: ENSMUSG00000061184
AA Change: T40K

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 183 5.19e-3 SMART
Tryp_SPc 199 425 8.42e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196462
AA Change: T40K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142902
Gene: ENSMUSG00000061184
AA Change: T40K

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 176 3.6e-4 SMART
Tryp_SPc 186 412 4.1e-93 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Akap8l C T 17: 32,338,803 G37R probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Cd81 T A 7: 143,066,319 N71K probably benign Het
Cemip G T 7: 83,998,562 D103E probably benign Het
Chfr A G 5: 110,170,863 K580E probably damaging Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cpb1 A T 3: 20,275,465 D32E probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
Eml5 A C 12: 98,841,581 D984E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hspa2 A G 12: 76,404,645 T38A possibly damaging Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kalrn C A 16: 34,176,262 probably null Het
Kmt2d T C 15: 98,865,248 D240G probably damaging Het
Lrrc56 T A 7: 141,198,294 D66E probably damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1089 A G 2: 86,733,577 F12L possibly damaging Het
Olfr1219 A G 2: 89,074,248 L281P probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr710 C A 7: 106,944,620 C127F probably damaging Het
Olfr832 A T 9: 18,944,816 H56L probably damaging Het
Pax8 A G 2: 24,443,102 I77T probably damaging Het
Paxbp1 T C 16: 91,034,934 I355M probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Plec A T 15: 76,176,947 I2952N probably damaging Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Ssc5d A G 7: 4,943,850 T1068A probably benign Het
Stambp A G 6: 83,551,978 S362P probably damaging Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tnk1 C T 11: 69,855,191 probably null Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xpnpep1 T G 19: 53,013,461 D118A probably damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Other mutations in Tmprss11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmprss11c APN 5 86239395 missense probably benign 0.00
IGL01357:Tmprss11c APN 5 86231807 missense probably damaging 1.00
IGL01809:Tmprss11c APN 5 86237662 missense possibly damaging 0.89
IGL02972:Tmprss11c APN 5 86237833 missense possibly damaging 0.77
IGL03135:Tmprss11c APN 5 86237650 missense probably damaging 1.00
IGL03255:Tmprss11c APN 5 86271482 missense probably damaging 0.99
IGL03355:Tmprss11c APN 5 86231871 missense probably benign 0.03
R0165:Tmprss11c UTSW 5 86231927 splice site probably benign
R0285:Tmprss11c UTSW 5 86271430 missense probably damaging 1.00
R0480:Tmprss11c UTSW 5 86237609 splice site probably benign
R0639:Tmprss11c UTSW 5 86235469 missense probably damaging 1.00
R1554:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R1651:Tmprss11c UTSW 5 86239424 missense probably damaging 1.00
R2235:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2698:Tmprss11c UTSW 5 86271463 missense probably damaging 1.00
R4787:Tmprss11c UTSW 5 86256453 missense probably benign 0.00
R4962:Tmprss11c UTSW 5 86237710 missense probably damaging 1.00
R5063:Tmprss11c UTSW 5 86237830 missense probably benign 0.28
R5217:Tmprss11c UTSW 5 86256390 missense probably benign
R5366:Tmprss11c UTSW 5 86282134 missense possibly damaging 0.93
R6343:Tmprss11c UTSW 5 86256345 missense probably damaging 1.00
R6598:Tmprss11c UTSW 5 86289233 missense probably benign 0.01
R6681:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R7170:Tmprss11c UTSW 5 86237619 critical splice donor site probably null
R7198:Tmprss11c UTSW 5 86231832 missense probably damaging 1.00
R7258:Tmprss11c UTSW 5 86271413 missense probably damaging 1.00
R7382:Tmprss11c UTSW 5 86231864 missense probably benign 0.19
R7391:Tmprss11c UTSW 5 86237791 missense probably damaging 1.00
R7590:Tmprss11c UTSW 5 86239473 missense probably benign 0.01
R7894:Tmprss11c UTSW 5 86231796 missense probably damaging 1.00
R8164:Tmprss11c UTSW 5 86231853 missense probably damaging 1.00
R8311:Tmprss11c UTSW 5 86235553 missense probably damaging 1.00
R8416:Tmprss11c UTSW 5 86239417 missense probably damaging 1.00
R8426:Tmprss11c UTSW 5 86231818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGACAAACTTTTGCGATG -3'
(R):5'- ATGCACAAACTCCACTGTTTCG -3'

Sequencing Primer
(F):5'- GACAAACTTTTGCGATGAACATTTAC -3'
(R):5'- AACTCCACTGTTTCGAAACTCTTCAG -3'
Posted On2014-10-15