Incidental Mutation 'R2310:Shq1'
ID244740
Institutional Source Beutler Lab
Gene Symbol Shq1
Ensembl Gene ENSMUSG00000035378
Gene NameSHQ1 homolog (S. cerevisiae)
Synonyms2810403P18Rik, Grim-1
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location100568256-100671157 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 100631002 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 316 (W316*)
Ref Sequence ENSEMBL: ENSMUSP00000127797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089245] [ENSMUST00000113312] [ENSMUST00000170667]
Predicted Effect probably benign
Transcript: ENSMUST00000089245
SMART Domains Protein: ENSMUSP00000086656
Gene: ENSMUSG00000035378

DomainStartEndE-ValueType
PDB:2K8Q|A 2 116 1e-9 PDB
low complexity region 117 132 N/A INTRINSIC
Pfam:SHQ1 237 308 1e-19 PFAM
low complexity region 341 362 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113312
AA Change: W316*
SMART Domains Protein: ENSMUSP00000108938
Gene: ENSMUSG00000035378
AA Change: W316*

DomainStartEndE-ValueType
PDB:2K8Q|A 2 116 1e-9 PDB
low complexity region 117 132 N/A INTRINSIC
Pfam:SHQ1 232 419 5.8e-72 PFAM
low complexity region 452 473 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170667
AA Change: W316*
SMART Domains Protein: ENSMUSP00000127797
Gene: ENSMUSG00000035378
AA Change: W316*

DomainStartEndE-ValueType
PDB:2K8Q|A 2 116 1e-9 PDB
low complexity region 117 132 N/A INTRINSIC
Pfam:SHQ1 241 416 8.5e-72 PFAM
low complexity region 452 473 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203525
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHQ1 assists in the assembly of H/ACA-box ribonucleoproteins that function in the processing of ribosomal RNAs, modification of spliceosomal small nuclear RNAs, and stabilization of telomerase (see MIM 602322) (Grozdanov et al., 2009 [PubMed 19383767]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Shq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Shq1 APN 6 100664483 missense probably benign 0.00
IGL01580:Shq1 APN 6 100573744 missense possibly damaging 0.94
IGL02125:Shq1 APN 6 100631006 missense probably benign 0.00
IGL02401:Shq1 APN 6 100648247 missense probably damaging 1.00
IGL02811:Shq1 APN 6 100630984 missense probably damaging 0.98
IGL03112:Shq1 APN 6 100573613 nonsense probably null
R0309:Shq1 UTSW 6 100573627 missense probably benign 0.01
R1163:Shq1 UTSW 6 100637072 missense probably damaging 1.00
R1456:Shq1 UTSW 6 100669698 critical splice donor site probably null
R1726:Shq1 UTSW 6 100637035 missense probably benign 0.03
R4428:Shq1 UTSW 6 100670928 missense probably damaging 1.00
R5038:Shq1 UTSW 6 100630993 missense probably benign 0.29
R5053:Shq1 UTSW 6 100655259 missense probably damaging 1.00
R5628:Shq1 UTSW 6 100631003 missense probably damaging 0.98
R5750:Shq1 UTSW 6 100611814 missense possibly damaging 0.67
R5817:Shq1 UTSW 6 100573720 missense probably damaging 0.96
R6504:Shq1 UTSW 6 100648247 missense probably benign 0.21
R7665:Shq1 UTSW 6 100573756 missense probably damaging 1.00
R7710:Shq1 UTSW 6 100671045 missense probably damaging 1.00
R7803:Shq1 UTSW 6 100671045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAACTCGTGATTGCATCTTCAC -3'
(R):5'- CACTTGTGGGTTTTCAGTCACC -3'

Sequencing Primer
(F):5'- TGTCTCGGTAGGCTTTCA -3'
(R):5'- TGTTGATGCAGTGTGAAGAATTC -3'
Posted On2014-10-30