Incidental Mutation 'R2310:Cpa3'
ID244728
Institutional Source Beutler Lab
Gene Symbol Cpa3
Ensembl Gene ENSMUSG00000001865
Gene Namecarboxypeptidase A3, mast cell
SynonymsMC-CPA, mast cell carboxypeptidase A, mMC-CPA
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location20215620-20242181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20227223 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 173 (C173Y)
Ref Sequence ENSEMBL: ENSMUSP00000001921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001921]
Predicted Effect probably damaging
Transcript: ENSMUST00000001921
AA Change: C173Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001921
Gene: ENSMUSG00000001865
AA Change: C173Y

DomainStartEndE-ValueType
Pfam:Propep_M14 27 103 9.5e-21 PFAM
Zn_pept 119 400 3.77e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191659
Meta Mutation Damage Score 0.8569 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases and preproprotein that is proteolytically processed to generate a mature protein product. This product is released by mast cells and may be involved in the degradation of endogenous proteins and the inactivation of venom-associated peptides. Homozygous knockout mice for this gene exhibit impaired mast cell development. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have immature peritoneal mast cells but normal mast cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Cpa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Cpa3 APN 3 20228815 missense possibly damaging 0.95
IGL02471:Cpa3 APN 3 20228807 critical splice donor site probably null
IGL02605:Cpa3 APN 3 20222212 missense probably benign 0.15
IGL03333:Cpa3 APN 3 20215828 missense possibly damaging 0.52
IGL03351:Cpa3 APN 3 20215962 missense probably benign
R0084:Cpa3 UTSW 3 20242101 splice site probably benign
R0632:Cpa3 UTSW 3 20225194 missense probably benign 0.00
R1017:Cpa3 UTSW 3 20239633 missense possibly damaging 0.86
R1334:Cpa3 UTSW 3 20222223 missense probably damaging 1.00
R1796:Cpa3 UTSW 3 20223227 splice site probably null
R3945:Cpa3 UTSW 3 20225117 missense probably damaging 1.00
R4467:Cpa3 UTSW 3 20228817 nonsense probably null
R4551:Cpa3 UTSW 3 20219770 missense probably benign 0.37
R4927:Cpa3 UTSW 3 20222139 missense probably damaging 1.00
R5159:Cpa3 UTSW 3 20227223 missense probably damaging 1.00
R5307:Cpa3 UTSW 3 20227163 critical splice donor site probably null
R5564:Cpa3 UTSW 3 20242143 missense possibly damaging 0.84
R6477:Cpa3 UTSW 3 20239575 missense possibly damaging 0.81
R7624:Cpa3 UTSW 3 20225143 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATGCAGACTTCTCTAACTAGGTG -3'
(R):5'- AGCTCTGAACCTTGGGAAATTTC -3'

Sequencing Primer
(F):5'- TGGAACACTTCTCATTTGGAAAGGG -3'
(R):5'- CTATGAATGGACAGGAGAGCTGCC -3'
Posted On2014-10-30