Incidental Mutation 'R2321:Ppp1r2'
ID245658
Institutional Source Beutler Lab
Gene Symbol Ppp1r2
Ensembl Gene ENSMUSG00000047714
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 2
Synonyms
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location31251537-31275277 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 31265303 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060188] [ENSMUST00000115233]
Predicted Effect probably null
Transcript: ENSMUST00000060188
SMART Domains Protein: ENSMUSP00000060118
Gene: ENSMUSG00000047714

DomainStartEndE-ValueType
Pfam:IPP-2 46 174 6.6e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115233
SMART Domains Protein: ENSMUSP00000110888
Gene: ENSMUSG00000047714

DomainStartEndE-ValueType
Pfam:IPP-2 43 175 1.4e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183720
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase-1 (PP1) is one of the main eukaryotic serine/threonine phosphatases. The protein encoded by this gene binds to the catalytic subunit of PP1, strongly inhibiting its activity. Ten related pseudogenes have been found throughout the human genome. Several splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice die during organogenesis. Heterozygous null mice display responses in behavioral assays suggesting enhanced memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Ppp1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4531001:Ppp1r2 UTSW 16 31258461 missense probably damaging 1.00
R4573:Ppp1r2 UTSW 16 31260637 missense possibly damaging 0.85
R6230:Ppp1r2 UTSW 16 31260600 missense possibly damaging 0.82
R7113:Ppp1r2 UTSW 16 31254718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTATCAGCAGCTAACAACCATCTAG -3'
(R):5'- AGGCCAGTTAAAGTCTAAGTATGTC -3'

Sequencing Primer
(F):5'- GTAGATCATCAACTAGCACTC -3'
(R):5'- GGAGTGTCTGATATGAATTATGGAAC -3'
Posted On2014-10-30