Incidental Mutation 'R2321:Pnmal2'
ID245640
Institutional Source Beutler Lab
Gene Symbol Pnmal2
Ensembl Gene ENSMUSG00000070802
Gene NamePNMA-like 2
SynonymsEG434128
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16944682-16948828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16945565 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 158 (R158L)
Ref Sequence ENSEMBL: ENSMUSP00000092401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094807]
Predicted Effect unknown
Transcript: ENSMUST00000094807
AA Change: R158L
SMART Domains Protein: ENSMUSP00000092401
Gene: ENSMUSG00000070802
AA Change: R158L

DomainStartEndE-ValueType
Pfam:PNMA 1 152 4.1e-36 PFAM
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 239 296 1.86e-6 PROSPERO
SCOP:d1qbkb_ 309 331 2e-3 SMART
internal_repeat_1 343 402 1.86e-6 PROSPERO
low complexity region 445 454 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
low complexity region 571 596 N/A INTRINSIC
low complexity region 612 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Pnmal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Pnmal2 APN 7 16945163 missense unknown
IGL02023:Pnmal2 APN 7 16945691 missense probably damaging 0.97
FR4737:Pnmal2 UTSW 7 16946006 small deletion probably benign
R0085:Pnmal2 UTSW 7 16945549 missense unknown
R2069:Pnmal2 UTSW 7 16945789 missense probably damaging 0.99
R2151:Pnmal2 UTSW 7 16945912 missense probably benign 0.00
R2929:Pnmal2 UTSW 7 16946692 missense possibly damaging 0.93
R3738:Pnmal2 UTSW 7 16946596 missense probably benign 0.00
R3739:Pnmal2 UTSW 7 16946596 missense probably benign 0.00
R5185:Pnmal2 UTSW 7 16945976 missense probably damaging 1.00
R5259:Pnmal2 UTSW 7 16945274 missense unknown
R5908:Pnmal2 UTSW 7 16947043 missense unknown
R5943:Pnmal2 UTSW 7 16946437 missense probably benign 0.25
R6101:Pnmal2 UTSW 7 16946568 missense probably benign 0.20
R6260:Pnmal2 UTSW 7 16946233 missense probably benign 0.03
R6583:Pnmal2 UTSW 7 16945919 missense probably damaging 0.97
R7007:Pnmal2 UTSW 7 16946256 missense possibly damaging 0.68
R7497:Pnmal2 UTSW 7 16944949 start gained probably benign
R8231:Pnmal2 UTSW 7 16946590 missense probably benign 0.01
R8278:Pnmal2 UTSW 7 16946338 missense probably damaging 0.99
RF003:Pnmal2 UTSW 7 16946016 small insertion probably benign
Z1176:Pnmal2 UTSW 7 16946810 missense possibly damaging 0.93
Z1177:Pnmal2 UTSW 7 16946968 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCATACCTATCCACATTAGGGG -3'
(R):5'- GGTCTTCATCTACGCTCAGGTC -3'

Sequencing Primer
(F):5'- CAAGATGCGCGGGTCCTTAG -3'
(R):5'- GCTCAGGTCCTCTGCGTAGATC -3'
Posted On2014-10-30