Mutagenetix > Incidental Mutation

Incidental Mutation 'R2343:Spata2'

245891

Institutional Source

Beutler Lab

Gene Symbol

Spata2

Ensembl Gene

ENSMUSG00000047030

Gene Name

spermatogenesis associated 2

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2343 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

167481133-167492887 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 167483360 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 513 (V513E)

Ref Sequence

ENSEMBL: ENSMUSP00000057095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057627] [ENSMUST00000109211]

AlphaFold

Q8K004

Predicted Effect

probably damaging
Transcript: ENSMUST00000057627
AA Change: V513E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057095
Gene: ENSMUSG00000047030
AA Change: V513E

Domain	Start	End	E-Value	Type
low complexity region	66	79	N/A	INTRINSIC
low complexity region	288	299	N/A	INTRINSIC
low complexity region	306	318	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109211

SMART Domains

Protein: ENSMUSP00000104834
Gene: ENSMUSG00000047030

Domain	Start	End	E-Value	Type
low complexity region	66	79	N/A	INTRINSIC
low complexity region	288	299	N/A	INTRINSIC
low complexity region	306	318	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126389

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147051

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154770

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155875

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous knockout leads to small testes, oligospermia, asthenozoospermia, reduced male fertility and decreased male germ cell numbers. It also affects necroptosis and increases inflammatory responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcr	T	C	10: 75,145,422	I691T	probably benign	Het
Col20a1	A	G	2: 181,001,331	T865A	possibly damaging	Het
Dmxl1	G	A	18: 49,890,678	R1676H	probably damaging	Het
Dsg2	T	C	18: 20,602,298	V1111A	probably damaging	Het
Eif3g	T	C	9: 20,895,154	Y213C	probably damaging	Het
Fat4	C	T	3: 38,957,105	S2118F	probably damaging	Het
Gpr85	A	G	6: 13,836,696	S70P	probably damaging	Het
Krtap31-1	A	C	11: 99,908,021	T17P	possibly damaging	Het
Lig1	A	G	7: 13,292,195		probably null	Het
Lman2l	A	T	1: 36,428,109	D269E	possibly damaging	Het
Mcc	A	G	18: 44,459,797		probably null	Het
Nav2	T	C	7: 49,598,817	F2302L	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1282	A	G	2: 111,335,700	I126T	probably damaging	Het
Olfr1342	C	A	4: 118,690,187	M88I	probably benign	Het
Sema6c	T	C	3: 95,167,083	F67L	probably damaging	Het
Sez6l	A	T	5: 112,464,731	V448D	probably damaging	Het
Smoc2	A	G	17: 14,344,342	K160R	probably benign	Het
Susd3	T	A	13: 49,238,859	M107L	probably damaging	Het
Tnni3k	A	G	3: 154,938,829	I564T	probably benign	Het
Zfp971	A	G	2: 178,032,994	K129E	possibly damaging	Het

Other mutations in Spata2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01538:Spata2	APN	2	167484151	missense	probably damaging	1.00
IGL01565:Spata2	APN	2	167484294	missense	probably damaging	0.96
IGL02661:Spata2	APN	2	167483361	missense	probably damaging	1.00
R0402:Spata2	UTSW	2	167483660	missense	probably benign
R1023:Spata2	UTSW	2	167485222	missense	probably benign
R1672:Spata2	UTSW	2	167483519	missense	probably damaging	1.00
R1989:Spata2	UTSW	2	167484314	missense	possibly damaging	0.93
R2422:Spata2	UTSW	2	167484206	missense	probably damaging	1.00
R5156:Spata2	UTSW	2	167483574	missense	probably damaging	0.96
R5476:Spata2	UTSW	2	167484159	missense	probably damaging	0.99
R6326:Spata2	UTSW	2	167484174	missense	possibly damaging	0.47
R7038:Spata2	UTSW	2	167485363	missense	possibly damaging	0.56
R7954:Spata2	UTSW	2	167483937	missense	probably benign	0.00
R8557:Spata2	UTSW	2	167484307	missense	probably damaging	1.00
R9459:Spata2	UTSW	2	167485285	missense	probably benign	0.35
X0024:Spata2	UTSW	2	167484446	missense	possibly damaging	0.62
Z1177:Spata2	UTSW	2	167483531	missense	probably damaging	1.00
Z1177:Spata2	UTSW	2	167483583	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGAATGTGACCTGCTACG -3'
(R):5'- TGGCACCTGTCCACTCAAAG -3'

Sequencing Primer
(F):5'- CTACGGGAGCCATGTGAC -3'
(R):5'- TCCCGCTGTGGCTTCTGTAAC -3'

Posted On

2014-10-30