Incidental Mutation 'R2343:Spata2'
ID245891
Institutional Source Beutler Lab
Gene Symbol Spata2
Ensembl Gene ENSMUSG00000047030
Gene Namespermatogenesis associated 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2343 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location167481133-167492887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167483360 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 513 (V513E)
Ref Sequence ENSEMBL: ENSMUSP00000057095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057627] [ENSMUST00000109211]
Predicted Effect probably damaging
Transcript: ENSMUST00000057627
AA Change: V513E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057095
Gene: ENSMUSG00000047030
AA Change: V513E

DomainStartEndE-ValueType
low complexity region 66 79 N/A INTRINSIC
low complexity region 288 299 N/A INTRINSIC
low complexity region 306 318 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109211
SMART Domains Protein: ENSMUSP00000104834
Gene: ENSMUSG00000047030

DomainStartEndE-ValueType
low complexity region 66 79 N/A INTRINSIC
low complexity region 288 299 N/A INTRINSIC
low complexity region 306 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155875
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout leads to small testes, oligospermia, asthenozoospermia, reduced male fertility and decreased male germ cell numbers. It also affects necroptosis and increases inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 75,145,422 I691T probably benign Het
Col20a1 A G 2: 181,001,331 T865A possibly damaging Het
Dmxl1 G A 18: 49,890,678 R1676H probably damaging Het
Dsg2 T C 18: 20,602,298 V1111A probably damaging Het
Eif3g T C 9: 20,895,154 Y213C probably damaging Het
Fat4 C T 3: 38,957,105 S2118F probably damaging Het
Gpr85 A G 6: 13,836,696 S70P probably damaging Het
Krtap31-1 A C 11: 99,908,021 T17P possibly damaging Het
Lig1 A G 7: 13,292,195 probably null Het
Lman2l A T 1: 36,428,109 D269E possibly damaging Het
Mcc A G 18: 44,459,797 probably null Het
Nav2 T C 7: 49,598,817 F2302L possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1282 A G 2: 111,335,700 I126T probably damaging Het
Olfr1342 C A 4: 118,690,187 M88I probably benign Het
Sema6c T C 3: 95,167,083 F67L probably damaging Het
Sez6l A T 5: 112,464,731 V448D probably damaging Het
Smoc2 A G 17: 14,344,342 K160R probably benign Het
Susd3 T A 13: 49,238,859 M107L probably damaging Het
Tnni3k A G 3: 154,938,829 I564T probably benign Het
Zfp971 A G 2: 178,032,994 K129E possibly damaging Het
Other mutations in Spata2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Spata2 APN 2 167484151 missense probably damaging 1.00
IGL01565:Spata2 APN 2 167484294 missense probably damaging 0.96
IGL02661:Spata2 APN 2 167483361 missense probably damaging 1.00
R0402:Spata2 UTSW 2 167483660 missense probably benign
R1023:Spata2 UTSW 2 167485222 missense probably benign
R1672:Spata2 UTSW 2 167483519 missense probably damaging 1.00
R1989:Spata2 UTSW 2 167484314 missense possibly damaging 0.93
R2422:Spata2 UTSW 2 167484206 missense probably damaging 1.00
R5156:Spata2 UTSW 2 167483574 missense probably damaging 0.96
R5476:Spata2 UTSW 2 167484159 missense probably damaging 0.99
R6326:Spata2 UTSW 2 167484174 missense possibly damaging 0.47
R7038:Spata2 UTSW 2 167485363 missense possibly damaging 0.56
X0024:Spata2 UTSW 2 167484446 missense possibly damaging 0.62
Z1177:Spata2 UTSW 2 167483531 missense probably damaging 1.00
Z1177:Spata2 UTSW 2 167483583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAATGTGACCTGCTACG -3'
(R):5'- TGGCACCTGTCCACTCAAAG -3'

Sequencing Primer
(F):5'- CTACGGGAGCCATGTGAC -3'
(R):5'- TCCCGCTGTGGCTTCTGTAAC -3'
Posted On2014-10-30