Incidental Mutation 'R2338:Olfr741'
ID246646
Institutional Source Beutler Lab
Gene Symbol Olfr741
Ensembl Gene ENSMUSG00000095765
Gene Nameolfactory receptor 741
SynonymsMOR106-15, MOR106-10, GA_x6K02T2PMLR-6197851-6198786
MMRRC Submission 040324-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2338 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50472738-50488338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50485640 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 61 (T61A)
Ref Sequence ENSEMBL: ENSMUSP00000151020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071932] [ENSMUST00000205518] [ENSMUST00000213903]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071932
AA Change: T61A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071824
Gene: ENSMUSG00000095765
AA Change: T61A

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.2e-55 PFAM
Pfam:7tm_1 45 294 2.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205518
AA Change: T61A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213903
AA Change: T61A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 36,095,152 D53G probably benign Het
4931440F15Rik C A 11: 29,823,718 A580S probably benign Het
A1cf C T 19: 31,932,545 P330S probably benign Het
A830010M20Rik T C 5: 107,510,574 L1158S probably damaging Het
Acta2 A G 19: 34,248,541 probably benign Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Cadps2 C G 6: 23,838,978 probably benign Het
Camsap3 C T 8: 3,606,808 R1048C probably damaging Het
Cdkl2 C T 5: 92,033,679 A148T possibly damaging Het
Dab2 T A 15: 6,435,252 I395K possibly damaging Het
Dclk2 A G 3: 86,799,017 F589S probably damaging Het
Ddx60 T C 8: 62,012,436 S1376P possibly damaging Het
Eprs T C 1: 185,415,808 F1256L probably damaging Het
Etaa1 A T 11: 17,945,605 probably null Het
Fat2 T C 11: 55,311,901 T116A possibly damaging Het
Fmnl3 T C 15: 99,370,227 T26A probably benign Het
Foxp1 A G 6: 99,003,293 V158A possibly damaging Het
G6pd2 T A 5: 61,810,008 D375E probably benign Het
Gne C T 4: 44,042,196 A460T probably damaging Het
Gprin1 T A 13: 54,738,425 probably null Het
Hecw2 T C 1: 53,904,422 M949V possibly damaging Het
Herc1 G A 9: 66,428,969 V1599M possibly damaging Het
Hk2 A C 6: 82,731,115 N628K probably damaging Het
Hmcn1 T C 1: 150,622,934 T4065A possibly damaging Het
Ipo8 T A 6: 148,789,823 Q683L probably benign Het
Krt81 A G 15: 101,463,336 I121T probably benign Het
Lamb2 T C 9: 108,482,141 L322P probably benign Het
Lilrb4a A G 10: 51,491,700 M113V probably benign Het
Mnat1 G A 12: 73,219,143 probably null Het
Mucl1 T A 15: 103,753,698 T68S possibly damaging Het
Npnt G T 3: 132,891,409 D461E probably damaging Het
Nrp1 A T 8: 128,497,904 Q716L probably benign Het
Olfr358 T G 2: 37,005,147 S156R probably damaging Het
Olfr623 A T 7: 103,660,410 I280N possibly damaging Het
Podxl2 T C 6: 88,849,196 Q376R probably damaging Het
Pudp T C 18: 50,568,575 D29G probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
S1pr3 T C 13: 51,419,578 I265T possibly damaging Het
Scgb1b2 A T 7: 31,291,613 C23* probably null Het
Spag8 G T 4: 43,652,826 R212S probably benign Het
Tacc2 A G 7: 130,733,569 probably null Het
Trmt1l C T 1: 151,428,959 probably benign Het
Trpa1 A T 1: 14,884,245 L810Q probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt3a1 T A 15: 9,291,973 probably benign Het
Vmn2r23 T G 6: 123,704,425 I97M possibly damaging Het
Vmn2r65 A T 7: 84,940,843 F622I possibly damaging Het
Vps13a C T 19: 16,720,453 G766E probably damaging Het
Wnk1 T C 6: 119,969,534 T553A probably benign Het
Xirp2 T A 2: 67,510,770 D1118E probably damaging Het
Zfyve9 A C 4: 108,660,614 D461E probably damaging Het
Other mutations in Olfr741
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Olfr741 APN 14 50485773 missense probably damaging 0.98
IGL01796:Olfr741 APN 14 50485541 missense probably benign 0.28
IGL01916:Olfr741 APN 14 50485493 missense probably benign 0.01
IGL02686:Olfr741 APN 14 50485969 missense probably benign 0.01
IGL02874:Olfr741 APN 14 50486229 missense possibly damaging 0.57
IGL02898:Olfr741 APN 14 50486186 missense probably damaging 1.00
PIT4515001:Olfr741 UTSW 14 50486079 missense probably benign 0.03
R0085:Olfr741 UTSW 14 50486334 missense probably benign 0.16
R1777:Olfr741 UTSW 14 50486300 missense probably benign 0.08
R1850:Olfr741 UTSW 14 50485598 missense probably benign
R2270:Olfr741 UTSW 14 50486037 missense probably damaging 1.00
R2971:Olfr741 UTSW 14 50485608 missense probably damaging 0.99
R4594:Olfr741 UTSW 14 50486162 missense probably benign 0.00
R5383:Olfr741 UTSW 14 50486052 nonsense probably null
R5708:Olfr741 UTSW 14 50485995 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R7116:Olfr741 UTSW 14 50485568 missense probably benign 0.00
R7702:Olfr741 UTSW 14 50486294 missense possibly damaging 0.79
R8169:Olfr741 UTSW 14 50486235 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGATGCTTTCACAGGTCACAGAC -3'
(R):5'- ATCAAATGCCATGACTGCCAG -3'

Sequencing Primer
(F):5'- GCTTTCACAGGTCACAGACAGATG -3'
(R):5'- CTGCCAGGAAAAAGCATTCTG -3'
Posted On2014-10-30