Mutagenetix > Incidental Mutation

Incidental Mutation 'R2338:Vmn2r23'

246626

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

040324-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R2338 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 123704425 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 97 (I97M)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172391
AA Change: I97M

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: I97M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.5%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	A	G	14: 36,095,152	D53G	probably benign	Het
4931440F15Rik	C	A	11: 29,823,718	A580S	probably benign	Het
A1cf	C	T	19: 31,932,545	P330S	probably benign	Het
A830010M20Rik	T	C	5: 107,510,574	L1158S	probably damaging	Het
Acta2	A	G	19: 34,248,541		probably benign	Het
Actrt3	A	G	3: 30,597,836	*370R	probably null	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Cadps2	C	G	6: 23,838,978		probably benign	Het
Camsap3	C	T	8: 3,606,808	R1048C	probably damaging	Het
Cdkl2	C	T	5: 92,033,679	A148T	possibly damaging	Het
Dab2	T	A	15: 6,435,252	I395K	possibly damaging	Het
Dclk2	A	G	3: 86,799,017	F589S	probably damaging	Het
Ddx60	T	C	8: 62,012,436	S1376P	possibly damaging	Het
Eprs	T	C	1: 185,415,808	F1256L	probably damaging	Het
Etaa1	A	T	11: 17,945,605		probably null	Het
Fat2	T	C	11: 55,311,901	T116A	possibly damaging	Het
Fmnl3	T	C	15: 99,370,227	T26A	probably benign	Het
Foxp1	A	G	6: 99,003,293	V158A	possibly damaging	Het
G6pd2	T	A	5: 61,810,008	D375E	probably benign	Het
Gne	C	T	4: 44,042,196	A460T	probably damaging	Het
Gprin1	T	A	13: 54,738,425		probably null	Het
Hecw2	T	C	1: 53,904,422	M949V	possibly damaging	Het
Herc1	G	A	9: 66,428,969	V1599M	possibly damaging	Het
Hk2	A	C	6: 82,731,115	N628K	probably damaging	Het
Hmcn1	T	C	1: 150,622,934	T4065A	possibly damaging	Het
Ipo8	T	A	6: 148,789,823	Q683L	probably benign	Het
Krt81	A	G	15: 101,463,336	I121T	probably benign	Het
Lamb2	T	C	9: 108,482,141	L322P	probably benign	Het
Lilrb4a	A	G	10: 51,491,700	M113V	probably benign	Het
Mnat1	G	A	12: 73,219,143		probably null	Het
Mucl1	T	A	15: 103,753,698	T68S	possibly damaging	Het
Npnt	G	T	3: 132,891,409	D461E	probably damaging	Het
Nrp1	A	T	8: 128,497,904	Q716L	probably benign	Het
Olfr358	T	G	2: 37,005,147	S156R	probably damaging	Het
Olfr623	A	T	7: 103,660,410	I280N	possibly damaging	Het
Olfr741	A	G	14: 50,485,640	T61A	possibly damaging	Het
Podxl2	T	C	6: 88,849,196	Q376R	probably damaging	Het
Pudp	T	C	18: 50,568,575	D29G	probably benign	Het
Rrs1	C	A	1: 9,545,801		probably null	Het
S1pr3	T	C	13: 51,419,578	I265T	possibly damaging	Het
Scgb1b2	A	T	7: 31,291,613	C23*	probably null	Het
Spag8	G	T	4: 43,652,826	R212S	probably benign	Het
Tacc2	A	G	7: 130,733,569		probably null	Het
Trmt1l	C	T	1: 151,428,959		probably benign	Het
Trpa1	A	T	1: 14,884,245	L810Q	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ugt3a1	T	A	15: 9,291,973		probably benign	Het
Vmn2r65	A	T	7: 84,940,843	F622I	possibly damaging	Het
Vps13a	C	T	19: 16,720,453	G766E	probably damaging	Het
Wnk1	T	C	6: 119,969,534	T553A	probably benign	Het
Xirp2	T	A	2: 67,510,770	D1118E	probably damaging	Het
Zfyve9	A	C	4: 108,660,614	D461E	probably damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAGAATTTGAGAGGGAGCAG -3'
(R):5'- GCATACCTGTGGGACATTGT -3'

Sequencing Primer
(F):5'- CAGAGGGGTAGCTGCAGG -3'
(R):5'- CATACCTGTGGGACATTGTAGAGAC -3'

Posted On

2014-10-30