Incidental Mutation 'R2338:Vmn2r23'
ID 246626
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 040324-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R2338 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 123702821-123742291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 123704425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 97 (I97M)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect possibly damaging
Transcript: ENSMUST00000172391
AA Change: I97M

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: I97M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 36,095,152 D53G probably benign Het
4931440F15Rik C A 11: 29,823,718 A580S probably benign Het
A1cf C T 19: 31,932,545 P330S probably benign Het
A830010M20Rik T C 5: 107,510,574 L1158S probably damaging Het
Acta2 A G 19: 34,248,541 probably benign Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Cadps2 C G 6: 23,838,978 probably benign Het
Camsap3 C T 8: 3,606,808 R1048C probably damaging Het
Cdkl2 C T 5: 92,033,679 A148T possibly damaging Het
Dab2 T A 15: 6,435,252 I395K possibly damaging Het
Dclk2 A G 3: 86,799,017 F589S probably damaging Het
Ddx60 T C 8: 62,012,436 S1376P possibly damaging Het
Eprs T C 1: 185,415,808 F1256L probably damaging Het
Etaa1 A T 11: 17,945,605 probably null Het
Fat2 T C 11: 55,311,901 T116A possibly damaging Het
Fmnl3 T C 15: 99,370,227 T26A probably benign Het
Foxp1 A G 6: 99,003,293 V158A possibly damaging Het
G6pd2 T A 5: 61,810,008 D375E probably benign Het
Gne C T 4: 44,042,196 A460T probably damaging Het
Gprin1 T A 13: 54,738,425 probably null Het
Hecw2 T C 1: 53,904,422 M949V possibly damaging Het
Herc1 G A 9: 66,428,969 V1599M possibly damaging Het
Hk2 A C 6: 82,731,115 N628K probably damaging Het
Hmcn1 T C 1: 150,622,934 T4065A possibly damaging Het
Ipo8 T A 6: 148,789,823 Q683L probably benign Het
Krt81 A G 15: 101,463,336 I121T probably benign Het
Lamb2 T C 9: 108,482,141 L322P probably benign Het
Lilrb4a A G 10: 51,491,700 M113V probably benign Het
Mnat1 G A 12: 73,219,143 probably null Het
Mucl1 T A 15: 103,753,698 T68S possibly damaging Het
Npnt G T 3: 132,891,409 D461E probably damaging Het
Nrp1 A T 8: 128,497,904 Q716L probably benign Het
Olfr358 T G 2: 37,005,147 S156R probably damaging Het
Olfr623 A T 7: 103,660,410 I280N possibly damaging Het
Olfr741 A G 14: 50,485,640 T61A possibly damaging Het
Podxl2 T C 6: 88,849,196 Q376R probably damaging Het
Pudp T C 18: 50,568,575 D29G probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
S1pr3 T C 13: 51,419,578 I265T possibly damaging Het
Scgb1b2 A T 7: 31,291,613 C23* probably null Het
Spag8 G T 4: 43,652,826 R212S probably benign Het
Tacc2 A G 7: 130,733,569 probably null Het
Trmt1l C T 1: 151,428,959 probably benign Het
Trpa1 A T 1: 14,884,245 L810Q probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt3a1 T A 15: 9,291,973 probably benign Het
Vmn2r65 A T 7: 84,940,843 F622I possibly damaging Het
Vps13a C T 19: 16,720,453 G766E probably damaging Het
Wnk1 T C 6: 119,969,534 T553A probably benign Het
Xirp2 T A 2: 67,510,770 D1118E probably damaging Het
Zfyve9 A C 4: 108,660,614 D461E probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123742079 missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123741823 missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123712713 missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123712713 missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCAGAATTTGAGAGGGAGCAG -3'
(R):5'- GCATACCTGTGGGACATTGT -3'

Sequencing Primer
(F):5'- CAGAGGGGTAGCTGCAGG -3'
(R):5'- CATACCTGTGGGACATTGTAGAGAC -3'
Posted On 2014-10-30