Incidental Mutation 'R2379:Btc'
ID248375
Institutional Source Beutler Lab
Gene Symbol Btc
Ensembl Gene ENSMUSG00000082361
Gene Namebetacellulin, epidermal growth factor family member
Synonyms
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2379 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location91357261-91402994 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 91376909 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121044] [ENSMUST00000200860]
Predicted Effect probably benign
Transcript: ENSMUST00000121044
SMART Domains Protein: ENSMUSP00000112765
Gene: ENSMUSG00000082361

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
EGF 68 105 4.32e-1 SMART
transmembrane domain 117 139 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200860
SMART Domains Protein: ENSMUSP00000143920
Gene: ENSMUSG00000082361

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201252
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family. These growth factors are ligands for the EGFR/ErbB receptor tyrosine kinases, and play roles in cell growth and differentiation. The encoded protein is synthesized as a transmembrane precursor that is proteolytically cleaved to generate a mature peptide, and plays a role in the differentiation of pancreatic beta cells. This gene may also play a protective role in acute pancreatitis, whereas increased expression of this gene may contribute to diabetic macular edema. Gene therapy using combinations of this gene and other pancreas-specific transcription factors may induce islet neogenesis and remediate hyperglycemia in type 1 diabetes. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no overt defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Btc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02434:Btc APN 5 91362327 missense probably damaging 0.98
R1570:Btc UTSW 5 91402717 missense unknown
R1929:Btc UTSW 5 91362401 missense probably damaging 1.00
R4965:Btc UTSW 5 91362301 splice site probably null
R5344:Btc UTSW 5 91376920 missense possibly damaging 0.77
R5928:Btc UTSW 5 91366145 missense probably damaging 0.98
R7072:Btc UTSW 5 91402937 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GACCTTTGGTGAGATAACCTTAAGG -3'
(R):5'- TCCACAGTGGGTCATGACAC -3'

Sequencing Primer
(F):5'- GTGAGATAACCTTAAGGGAGTTTTG -3'
(R):5'- TCCACAGTGGGTCATGACACTAAAAG -3'
Posted On2014-11-11