Incidental Mutation 'R2379:Sla2'
ID248370
Institutional Source Beutler Lab
Gene Symbol Sla2
Ensembl Gene ENSMUSG00000027636
Gene NameSrc-like-adaptor 2
SynonymsSLAP-2, A930009E21Rik, SLAP2
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2379 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156872457-156887192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156875942 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 137 (R137C)
Ref Sequence ENSEMBL: ENSMUSP00000105189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029164] [ENSMUST00000029165] [ENSMUST00000109561]
Predicted Effect probably damaging
Transcript: ENSMUST00000029164
AA Change: R137C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029164
Gene: ENSMUSG00000027636
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029165
SMART Domains Protein: ENSMUSP00000029165
Gene: ENSMUSG00000027637

DomainStartEndE-ValueType
Pfam:Rab5ip 44 123 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109561
AA Change: R137C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105189
Gene: ENSMUSG00000027636
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152551
Meta Mutation Damage Score 0.3138 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLAP family of adapter proteins. The encoded protein may play an important receptor-proximal role in downregulating T and B cell-mediated responses and inhibits antigen receptor-induced calcium mobilization. This protein interacts with Cas-Br-M (murine) ecotropic retroviral transforming sequence c. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Sla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0992:Sla2 UTSW 2 156874472 missense probably damaging 0.99
R2250:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2257:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2377:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2378:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2442:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2443:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2843:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3416:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3417:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3499:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3792:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3793:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3878:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R5664:Sla2 UTSW 2 156874999 missense probably benign 0.04
R6784:Sla2 UTSW 2 156883669 missense unknown
R7356:Sla2 UTSW 2 156878703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCAGCAGGTCAAGCCTCTAAG -3'
(R):5'- TCCTGAGGACCACAGAATCC -3'

Sequencing Primer
(F):5'- GGGCACAACTGACTATCTCCTAGG -3'
(R):5'- TGAGGACCACAGAATCCTATTAC -3'
Posted On2014-11-11