Incidental Mutation 'R2379:Asb16'
ID248397
Institutional Source Beutler Lab
Gene Symbol Asb16
Ensembl Gene ENSMUSG00000034768
Gene Nameankyrin repeat and SOCS box-containing 16
Synonyms
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R2379 (G1)
Quality Score196
Status Validated
Chromosome11
Chromosomal Location102268743-102279462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102272531 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 116 (T116A)
Ref Sequence ENSEMBL: ENSMUSP00000038450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036467]
Predicted Effect probably benign
Transcript: ENSMUST00000036467
AA Change: T116A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038450
Gene: ENSMUSG00000034768
AA Change: T116A

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Blast:ANK 56 85 3e-9 BLAST
ANK 110 139 5.29e0 SMART
ANK 142 171 2.1e-3 SMART
ANK 175 204 5.93e-3 SMART
ANK 209 238 1.4e1 SMART
ANK 242 279 9.21e0 SMART
ANK 283 312 2.18e-1 SMART
Blast:ANK 316 352 7e-17 BLAST
Blast:ANK 354 379 2e-8 BLAST
SOCS_box 408 447 1.26e-7 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Asb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Asb16 APN 11 102276749 missense probably damaging 1.00
R1540:Asb16 UTSW 11 102272576 missense probably benign 0.37
R1589:Asb16 UTSW 11 102268995 missense probably damaging 1.00
R1845:Asb16 UTSW 11 102276756 missense possibly damaging 0.54
R3686:Asb16 UTSW 11 102269059 missense probably benign 0.19
R4591:Asb16 UTSW 11 102276725 missense probably damaging 0.97
R5205:Asb16 UTSW 11 102268994 missense probably damaging 1.00
R6505:Asb16 UTSW 11 102276477 missense probably damaging 0.99
R6649:Asb16 UTSW 11 102269037 missense possibly damaging 0.56
R7275:Asb16 UTSW 11 102269109 missense probably damaging 1.00
R7436:Asb16 UTSW 11 102272655 missense possibly damaging 0.87
R7828:Asb16 UTSW 11 102277927 missense probably benign 0.02
R7935:Asb16 UTSW 11 102277913 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCTCTTCCAACGTATACTCC -3'
(R):5'- CGATACATTAGCCTTGGCACC -3'

Sequencing Primer
(F):5'- GCTTTGAGTGGACCCCCTAAC -3'
(R):5'- GATACATTAGCCTTGGCACCAAATG -3'
Posted On2014-11-11