Incidental Mutation 'R2422:Dnajc21'
ID249397
Institutional Source Beutler Lab
Gene Symbol Dnajc21
Ensembl Gene ENSMUSG00000044224
Gene NameDnaJ heat shock protein family (Hsp40) member C21
Synonyms9930116P15Rik, 4930461P20Rik
MMRRC Submission 040384-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R2422 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10446756-10470516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10461935 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 127 (S127P)
Ref Sequence ENSEMBL: ENSMUSP00000116865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136591]
Predicted Effect probably benign
Transcript: ENSMUST00000136591
AA Change: S127P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116865
Gene: ENSMUSG00000044224
AA Change: S127P

DomainStartEndE-ValueType
DnaJ 2 61 7.2e-29 SMART
coiled coil region 178 283 N/A INTRINSIC
ZnF_U1 311 345 5.3e-8 SMART
ZnF_C2H2 314 338 1.67e-2 SMART
low complexity region 379 393 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
ZnF_C2H2 483 507 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145719
SMART Domains Protein: ENSMUSP00000116192
Gene: ENSMUSG00000044224

DomainStartEndE-ValueType
coiled coil region 26 131 N/A INTRINSIC
ZnF_U1 160 194 5.3e-8 SMART
ZnF_C2H2 163 187 1.67e-2 SMART
low complexity region 228 242 N/A INTRINSIC
low complexity region 301 319 N/A INTRINSIC
ZnF_C2H2 332 356 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147224
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the precursor 45S ribosomal RNA and may be involved in early nuclear ribosomal RNA biogenesis and maturation of the 60S ribosomal subunit. Mutations in this gene result in Bone marrow failure syndrome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
4933409G03Rik A T 2: 68,591,520 N47I probably benign Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adck2 C T 6: 39,583,998 A440V possibly damaging Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Ccdc77 A G 6: 120,339,159 C186R probably benign Het
Cdk12 T G 11: 98,219,074 S640R probably benign Het
Cdv3 T C 9: 103,365,118 probably benign Het
Celf2 G A 2: 6,553,889 T364I probably damaging Het
Cmtr2 C A 8: 110,222,781 S574R probably benign Het
Col14a1 T C 15: 55,449,922 L56P unknown Het
Dctn1 C T 6: 83,199,800 L1241F possibly damaging Het
Depdc5 T C 5: 32,991,035 F1505S probably damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Entpd7 A T 19: 43,728,088 Y507F possibly damaging Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Galr1 A T 18: 82,405,923 N76K probably damaging Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm4950 T A 18: 51,865,784 Q33L probably benign Het
Gm5415 C T 1: 32,545,861 A323T possibly damaging Het
Gm6583 A T 5: 112,355,118 V240D probably damaging Het
Gnat2 A T 3: 108,095,539 M88L probably damaging Het
Gpr183 A G 14: 121,954,177 Y311H probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hipk3 C T 2: 104,471,485 G121R probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Homez C A 14: 54,857,574 V226F probably benign Het
Inf2 C A 12: 112,610,824 A1034D unknown Het
Kcnc4 G T 3: 107,445,547 P572T probably benign Het
Kmt2d T C 15: 98,862,266 E1037G unknown Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lmbrd2 C T 15: 9,194,765 T618M possibly damaging Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mib1 T C 18: 10,751,906 S263P probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Nek1 T C 8: 61,019,901 V152A probably damaging Het
Nlrp4d T A 7: 10,362,945 D876V probably benign Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr235 A T 19: 12,268,919 T230S probably damaging Het
Olfr740 T C 14: 50,453,436 L128P probably damaging Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pcdha11 G T 18: 37,007,272 L651F probably damaging Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Plxnb1 G A 9: 109,108,438 R1169H probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Pum2 A T 12: 8,748,931 Q930L possibly damaging Het
Rbp4 T C 19: 38,124,344 E67G probably damaging Het
Rgs9 C A 11: 109,225,777 probably null Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Smc1a A G X: 152,047,975 probably benign Het
Snx33 C A 9: 56,918,538 M546I probably benign Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Spata2 C T 2: 167,484,206 R231Q probably damaging Het
Stard9 C T 2: 120,700,284 R2341C probably benign Het
Tas2r116 A T 6: 132,855,594 I53F possibly damaging Het
Tlk1 T C 2: 70,770,005 E110G probably damaging Het
Tmem102 T A 11: 69,804,537 E203V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wdr77 A T 3: 105,960,021 K62* probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp266 C A 9: 20,499,262 V540L possibly damaging Het
Zfp638 C A 6: 83,966,439 probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp951 G A 5: 104,815,277 T141I probably benign Het
Other mutations in Dnajc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Dnajc21 APN 15 10447102 missense probably benign 0.01
IGL02797:Dnajc21 APN 15 10461355 missense probably damaging 0.96
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R1480:Dnajc21 UTSW 15 10459951 splice site probably null
R1694:Dnajc21 UTSW 15 10451563 missense probably benign 0.00
R1777:Dnajc21 UTSW 15 10449607 missense probably benign 0.00
R2420:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2421:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R4065:Dnajc21 UTSW 15 10451553 critical splice donor site probably null
R4182:Dnajc21 UTSW 15 10459933 intron probably null
R4546:Dnajc21 UTSW 15 10447097 missense probably benign 0.01
R4644:Dnajc21 UTSW 15 10463917 missense possibly damaging 0.89
R4939:Dnajc21 UTSW 15 10449597 missense probably damaging 0.96
R5075:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R5187:Dnajc21 UTSW 15 10463964 missense probably benign 0.21
R5273:Dnajc21 UTSW 15 10454807 missense probably damaging 1.00
R5590:Dnajc21 UTSW 15 10462277 missense possibly damaging 0.92
R5643:Dnajc21 UTSW 15 10461915 missense probably benign
R5644:Dnajc21 UTSW 15 10461915 missense probably benign
R5729:Dnajc21 UTSW 15 10449596 missense probably benign 0.01
R6614:Dnajc21 UTSW 15 10470263 critical splice donor site probably null
R6815:Dnajc21 UTSW 15 10447691 splice site probably null
R7016:Dnajc21 UTSW 15 10461407 nonsense probably null
R7076:Dnajc21 UTSW 15 10449631 missense probably benign
R7584:Dnajc21 UTSW 15 10462295 nonsense probably null
R7624:Dnajc21 UTSW 15 10461232 missense probably benign 0.07
R7624:Dnajc21 UTSW 15 10461234 missense probably damaging 0.98
R7676:Dnajc21 UTSW 15 10462344 missense possibly damaging 0.95
R7788:Dnajc21 UTSW 15 10460047 missense probably damaging 1.00
R7845:Dnajc21 UTSW 15 10447141 missense probably damaging 1.00
R7928:Dnajc21 UTSW 15 10447141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCAGTACAAGCTCCGG -3'
(R):5'- AATGTGGGGCTGTCCTAAAATTG -3'

Sequencing Primer
(F):5'- GTACAAGCTCCGGCAAAAATG -3'
(R):5'- TGAATGCACGTCTGTTTAAGC -3'
Posted On2014-11-12