Incidental Mutation 'R2518:Tas2r130'
ID254061
Institutional Source Beutler Lab
Gene Symbol Tas2r130
Ensembl Gene ENSMUSG00000054497
Gene Nametaste receptor, type 2, member 130
SynonymsT2R30, mt2r42, STC 7-4, Tas2r30
MMRRC Submission 040422-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2518 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location131629823-131630912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131630073 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 253 (I253K)
Ref Sequence ENSEMBL: ENSMUSP00000063954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067597]
Predicted Effect probably damaging
Transcript: ENSMUST00000067597
AA Change: I253K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063954
Gene: ENSMUSG00000054497
AA Change: I253K

DomainStartEndE-ValueType
Pfam:TAS2R 1 304 1.7e-110 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Adam18 A G 8: 24,637,141 C480R probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Ccdc146 T C 5: 21,305,528 H527R probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdac5 A G 11: 102,197,136 V949A probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Olfr294 A T 7: 86,616,187 F153I probably benign Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Ren1 G A 1: 133,360,124 A399T probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Skint1 T C 4: 112,025,481 W241R probably benign Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tarbp2 A G 15: 102,518,557 E3G possibly damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tjap1 A T 17: 46,260,095 N165K probably damaging Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Tst T C 15: 78,405,833 M1V probably null Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Tas2r130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Tas2r130 APN 6 131630271 missense probably damaging 1.00
IGL01412:Tas2r130 APN 6 131630510 nonsense probably null
IGL01554:Tas2r130 APN 6 131630083 missense probably benign 0.44
IGL01789:Tas2r130 APN 6 131630155 missense probably damaging 1.00
R1552:Tas2r130 UTSW 6 131630167 missense probably benign 0.00
R1848:Tas2r130 UTSW 6 131630597 missense probably benign 0.00
R2020:Tas2r130 UTSW 6 131630769 missense probably damaging 1.00
R2060:Tas2r130 UTSW 6 131630817 missense probably benign 0.00
R3810:Tas2r130 UTSW 6 131630829 start codon destroyed probably null 1.00
R5666:Tas2r130 UTSW 6 131630379 missense possibly damaging 0.82
R6225:Tas2r130 UTSW 6 131630584 small deletion probably benign
R7180:Tas2r130 UTSW 6 131630248 missense probably benign 0.00
R7284:Tas2r130 UTSW 6 131630307 missense probably benign 0.02
R7385:Tas2r130 UTSW 6 131630263 missense probably benign
R8424:Tas2r130 UTSW 6 131630827 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACGGATAATGATCGTGTCTTCC -3'
(R):5'- AACTTGGTCATGCTGTTCCC -3'

Sequencing Primer
(F):5'- TTTCTTCAGATATGCTCATGATGC -3'
(R):5'- GGTCATGCTGTTCCCCTTTTCTG -3'
Posted On2014-12-04