Mutagenetix > Incidental Mutations

Incidental Mutation 'R2518:Irs2'

254073

Institutional Source

Beutler Lab

Gene Symbol

Irs2

Ensembl Gene

ENSMUSG00000038894

Gene Name

insulin receptor substrate 2

Synonyms

Irs-2

MMRRC Submission

040422-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.532) question?

Stock #

R2518 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10984681-11008458 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 11005352 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 1027 (A1027S)

Ref Sequence

ENSEMBL: ENSMUSP00000038514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040514]

PDB Structure

Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000040514
AA Change: A1027S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: A1027S

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	19	28	N/A	INTRINSIC
PH	31	146	2.83e-13	SMART
IRS	191	293	4.98e-38	SMART
PTBI	191	293	2.24e-51	SMART
low complexity region	301	309	N/A	INTRINSIC
low complexity region	364	377	N/A	INTRINSIC
low complexity region	435	473	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	688	710	N/A	INTRINSIC
low complexity region	721	730	N/A	INTRINSIC
low complexity region	834	846	N/A	INTRINSIC
low complexity region	923	959	N/A	INTRINSIC
low complexity region	976	984	N/A	INTRINSIC
low complexity region	997	1028	N/A	INTRINSIC
low complexity region	1137	1154	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC
low complexity region	1274	1296	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180750

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110034G24Rik	T	A	2: 132,750,527	S165T	probably damaging	Het
Adam18	A	G	8: 24,637,141	C480R	probably damaging	Het
Aftph	G	T	11: 20,725,797	T604K	probably damaging	Het
Bivm	T	C	1: 44,129,615	V279A	probably damaging	Het
C2cd2	G	A	16: 97,922,086	T77I	probably benign	Het
Ccdc146	T	C	5: 21,305,528	H527R	probably benign	Het
Cd226	A	G	18: 89,207,327	N116S	probably benign	Het
Cit	A	G	5: 115,987,046	K1612E	probably damaging	Het
Cmtr1	T	A	17: 29,681,980	Y663*	probably null	Het
Col3a1	T	A	1: 45,337,512		probably benign	Het
Copa	A	G	1: 172,119,901	N1095D	probably benign	Het
Cpne1	G	T	2: 156,073,971	A433E	probably damaging	Het
Cyfip1	C	T	7: 55,928,284	L1181F	probably damaging	Het
Dnajc6	T	A	4: 101,612,930	I220N	probably damaging	Het
Duxbl1	G	C	14: 25,987,748		probably benign	Het
Fam135b	C	T	15: 71,463,911	R478H	probably benign	Het
Fam91a1	T	A	15: 58,450,600	S734T	possibly damaging	Het
Fut10	T	G	8: 31,236,467	S417A	probably benign	Het
Gm9945	C	T	11: 53,480,336		probably benign	Het
Golga4	A	G	9: 118,556,612	E934G	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Hdac5	A	G	11: 102,197,136	V949A	probably damaging	Het
Hdgfl1	G	T	13: 26,769,749	L114I	probably benign	Het
Ifi27l2b	T	A	12: 103,455,824	M94L	unknown	Het
Itga2	A	T	13: 114,881,042	C111S	probably damaging	Het
Khdrbs1	T	C	4: 129,720,747	T338A	probably benign	Het
Klk1	T	C	7: 44,220,737		probably null	Het
Kmt2b	T	C	7: 30,576,068	N1822S	probably benign	Het
Lrig3	T	C	10: 125,994,441	I136T	probably benign	Het
Lyar	T	A	5: 38,227,932	D105E	probably benign	Het
Mat1a	T	A	14: 41,122,512	D366E	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naip1	A	T	13: 100,423,219	D1092E	probably benign	Het
Neb	T	A	2: 52,249,511	K95*	probably null	Het
Nectin4	A	G	1: 171,380,208	D56G	probably benign	Het
Nupl1	A	T	14: 60,232,660	F334Y	probably damaging	Het
Olfr1502	A	G	19: 13,862,309	N172S	probably damaging	Het
Olfr294	A	T	7: 86,616,187	F153I	probably benign	Het
Pde8a	C	A	7: 81,317,422	T437K	probably benign	Het
Ppp1r3a	A	T	6: 14,719,378	N512K	possibly damaging	Het
Pqlc2	A	G	4: 139,302,499	F74L	probably damaging	Het
Pramef8	A	G	4: 143,417,903	Q273R	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,067	D330G	probably damaging	Het
Ren1	G	A	1: 133,360,124	A399T	probably damaging	Het
Rnft2	G	T	5: 118,194,605		probably benign	Het
Sept14	A	T	5: 129,699,035	S27T	probably benign	Het
Shox2	T	C	3: 66,978,359	K128E	possibly damaging	Het
Skint1	T	C	4: 112,025,481	W241R	probably benign	Het
Slc24a4	T	A	12: 102,222,051	H134Q	probably benign	Het
Slc25a36	A	T	9: 97,079,071	L165Q	possibly damaging	Het
Slc35f1	A	G	10: 53,073,534	I240V	probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tarbp2	A	G	15: 102,518,557	E3G	possibly damaging	Het
Tas2r130	A	T	6: 131,630,073	I253K	probably damaging	Het
Timm44	A	C	8: 4,266,588	C319G	probably null	Het
Tjap1	A	T	17: 46,260,095	N165K	probably damaging	Het
Tmem63b	A	G	17: 45,666,154	I429T	probably benign	Het
Trabd2b	A	T	4: 114,599,903	D339V	probably damaging	Het
Tst	T	C	15: 78,405,833	M1V	probably null	Het
Ube4a	A	T	9: 44,948,137	N335K	probably benign	Het
Vps54	C	T	11: 21,306,394	T633M	probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp953	A	G	13: 67,347,939	Y13H	probably damaging	Het

Other mutations in Irs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Irs2	APN	8	11005867	missense	probably benign	0.00
IGL01328:Irs2	APN	8	11004792	missense	probably damaging	0.99
IGL01875:Irs2	APN	8	11006221	missense	probably damaging	0.98
IGL02444:Irs2	APN	8	11006306	missense	probably benign	0.03
IGL02448:Irs2	APN	8	11007862	missense	probably benign	0.21
IGL02945:Irs2	APN	8	11007781	missense	probably damaging	1.00
IGL03068:Irs2	APN	8	11004974	missense	probably damaging	0.99
beefed	UTSW	8	11006522	nonsense	probably null
Dum_dum	UTSW	8	10987012	makesense	probably null
Lush	UTSW	8	11006678	nonsense	probably null
muscular	UTSW	8	11004659	nonsense	probably null
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0107:Irs2	UTSW	8	11004691	missense	probably damaging	1.00
R0147:Irs2	UTSW	8	11007568	missense	probably damaging	1.00
R0501:Irs2	UTSW	8	11006396	missense	probably damaging	1.00
R0565:Irs2	UTSW	8	11004592	missense	probably damaging	0.98
R2042:Irs2	UTSW	8	11007580	missense	probably damaging	0.99
R2268:Irs2	UTSW	8	11007586	missense	probably damaging	0.98
R2762:Irs2	UTSW	8	11006408	missense	probably damaging	1.00
R3623:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R3624:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R5022:Irs2	UTSW	8	10987012	makesense	probably null
R5270:Irs2	UTSW	8	11006678	nonsense	probably null
R5377:Irs2	UTSW	8	11005277	missense	probably benign	0.00
R5604:Irs2	UTSW	8	11005007	missense	possibly damaging	0.84
R6049:Irs2	UTSW	8	11006805	missense	probably benign	0.01
R6219:Irs2	UTSW	8	11005121	missense	probably damaging	0.99
R6654:Irs2	UTSW	8	11006486	missense	probably damaging	1.00
R6726:Irs2	UTSW	8	11004961	missense	possibly damaging	0.86
R6813:Irs2	UTSW	8	11004659	nonsense	probably null
R6934:Irs2	UTSW	8	11004697	missense	probably damaging	0.99
R7261:Irs2	UTSW	8	11007018	missense	possibly damaging	0.95
R7285:Irs2	UTSW	8	11006797	missense	probably damaging	0.99
R7458:Irs2	UTSW	8	11007739	missense	probably damaging	0.99
R7757:Irs2	UTSW	8	11006522	nonsense	probably null
R8347:Irs2	UTSW	8	11008000	missense	possibly damaging	0.82
R8348:Irs2	UTSW	8	11004974	missense	probably damaging	0.98
R8377:Irs2	UTSW	8	11004848	nonsense	probably null
R8444:Irs2	UTSW	8	11006683	missense	probably damaging	0.99
Z1176:Irs2	UTSW	8	11006185	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCCATGAGACTTAGCCGCTTC -3'
(R):5'- TCTGACTATATGAACCTGGACTTC -3'

Sequencing Primer
(F):5'- TGAGACTTAGCCGCTTCAAGCC -3'
(R):5'- GAACCTGGACTTCAGTTCTCCCAAG -3'

Posted On

2014-12-04