Incidental Mutation 'R2518:Tst'
ID254123
Institutional Source Beutler Lab
Gene Symbol Tst
Ensembl Gene ENSMUSG00000044986
Gene Namethiosulfate sulfurtransferase, mitochondrial
SynonymsRhodanese
MMRRC Submission 040422-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2518 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78399556-78405907 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 78405833 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000055743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043865] [ENSMUST00000058659] [ENSMUST00000167140] [ENSMUST00000169133] [ENSMUST00000229739] [ENSMUST00000229791] [ENSMUST00000231159]
Predicted Effect probably benign
Transcript: ENSMUST00000043865
SMART Domains Protein: ENSMUSP00000043061
Gene: ENSMUSG00000071711

DomainStartEndE-ValueType
RHOD 11 141 1.36e-19 SMART
RHOD 164 285 1.11e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000058659
AA Change: M1V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055743
Gene: ENSMUSG00000044986
AA Change: M1V

DomainStartEndE-ValueType
RHOD 11 140 2.88e-18 SMART
RHOD 163 285 1.48e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167140
SMART Domains Protein: ENSMUSP00000130493
Gene: ENSMUSG00000071711

DomainStartEndE-ValueType
RHOD 11 141 1.36e-19 SMART
RHOD 164 285 1.11e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169133
SMART Domains Protein: ENSMUSP00000128075
Gene: ENSMUSG00000071711

DomainStartEndE-ValueType
RHOD 11 141 1.36e-19 SMART
RHOD 164 285 1.11e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229739
Predicted Effect probably benign
Transcript: ENSMUST00000229791
Predicted Effect probably benign
Transcript: ENSMUST00000231159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231525
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This is one of two neighboring genes encoding similar proteins that each contain two rhodanese domains. The encoded protein is localized to the mitochondria and catalyzes the conversion of thiosulfate and cyanide to thiocyanate and sulfite. In addition, the protein interacts with 5S ribosomal RNA and facilitates its import into the mitochondria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Adam18 A G 8: 24,637,141 C480R probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Ccdc146 T C 5: 21,305,528 H527R probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdac5 A G 11: 102,197,136 V949A probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Olfr294 A T 7: 86,616,187 F153I probably benign Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Ren1 G A 1: 133,360,124 A399T probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Skint1 T C 4: 112,025,481 W241R probably benign Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tarbp2 A G 15: 102,518,557 E3G possibly damaging Het
Tas2r130 A T 6: 131,630,073 I253K probably damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tjap1 A T 17: 46,260,095 N165K probably damaging Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Tst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Tst APN 15 78405461 missense probably damaging 1.00
IGL01457:Tst APN 15 78399767 missense probably benign 0.01
IGL01622:Tst APN 15 78399764 missense probably benign 0.06
IGL01623:Tst APN 15 78399764 missense probably benign 0.06
IGL03277:Tst APN 15 78405321 missense probably damaging 1.00
R0456:Tst UTSW 15 78405580 missense probably damaging 1.00
R1522:Tst UTSW 15 78399943 missense possibly damaging 0.67
R5456:Tst UTSW 15 78399958 missense probably damaging 1.00
R7623:Tst UTSW 15 78405703 missense probably damaging 1.00
R7765:Tst UTSW 15 78405616 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ATCTCATAAGGCGAAGTCGTG -3'
(R):5'- AGGGAATGTGCCAACCTCTC -3'

Sequencing Primer
(F):5'- TTCCTCTATATCAAAGAAGGACGCG -3'
(R):5'- TCCCACTGTGAGTCTGGC -3'
Posted On2014-12-04