Incidental Mutation 'R2924:Ints6l'
ID255684
Institutional Source Beutler Lab
Gene Symbol Ints6l
Ensembl Gene ENSMUSG00000035967
Gene Nameintegrator complex subunit 6 like
Synonyms6330505F04Rik, 4930535D10Rik, Ddx26b
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R2924 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location56454857-56507843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56504836 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 483 (E483G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039374] [ENSMUST00000132428] [ENSMUST00000186445]
Predicted Effect probably benign
Transcript: ENSMUST00000039374
AA Change: E707G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035379
Gene: ENSMUSG00000035967
AA Change: E707G

DomainStartEndE-ValueType
VWA 1 275 1.29e-1 SMART
Blast:VWA 311 335 1e-6 BLAST
low complexity region 617 633 N/A INTRINSIC
Pfam:INT_SG_DDX_CT_C 776 838 3.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132428
AA Change: E707G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138630
Gene: ENSMUSG00000035967
AA Change: E707G

DomainStartEndE-ValueType
VWA 1 275 1.29e-1 SMART
Blast:VWA 311 335 1e-6 BLAST
low complexity region 617 633 N/A INTRINSIC
Pfam:INT_SG_DDX_CT_C 775 839 2.1e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134138
Predicted Effect probably benign
Transcript: ENSMUST00000142624
SMART Domains Protein: ENSMUSP00000119095
Gene: ENSMUSG00000035967

DomainStartEndE-ValueType
Pfam:INT_SG_DDX_CT_C 1 55 2.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143142
AA Change: E483G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118865
Gene: ENSMUSG00000035967
AA Change: E483G

DomainStartEndE-ValueType
Blast:VWA 2 223 1e-148 BLAST
low complexity region 394 410 N/A INTRINSIC
Pfam:INT_SG_DDX_CT_C 553 615 1.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186445
AA Change: E707G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139507
Gene: ENSMUSG00000035967
AA Change: E707G

DomainStartEndE-ValueType
VWA 1 275 1.29e-1 SMART
Blast:VWA 311 335 1e-6 BLAST
low complexity region 617 633 N/A INTRINSIC
Pfam:INT_SG_DDX_CT_C 775 839 2.1e-34 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Ints6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Ints6l APN X 56496744 splice site probably benign
IGL02552:Ints6l APN X 56455197 utr 5 prime probably benign
IGL02974:Ints6l APN X 56506936 missense probably benign 0.00
IGL03224:Ints6l APN X 56497927 missense probably damaging 1.00
R0308:Ints6l UTSW X 56481355 missense possibly damaging 0.93
R0733:Ints6l UTSW X 56501748 missense probably benign 0.03
R0733:Ints6l UTSW X 56504812 missense probably benign 0.01
R2121:Ints6l UTSW X 56504868 missense probably benign
R2124:Ints6l UTSW X 56504868 missense probably benign
R2191:Ints6l UTSW X 56504750 missense probably benign 0.03
R2192:Ints6l UTSW X 56504750 missense probably benign 0.03
R3775:Ints6l UTSW X 56481371 missense probably damaging 1.00
Z1176:Ints6l UTSW X 56497935 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTAGCTGGAAGGTCACAAGTC -3'
(R):5'- TTGGCACCGTTTCCAAAGC -3'

Sequencing Primer
(F):5'- GTTCAGAACATGTCTCACAGGATGC -3'
(R):5'- CGTTTCCAAAGCAGATGCCATTG -3'
Posted On2014-12-29