Incidental Mutation 'R0328:Tmem131l'
ID25832
Institutional Source Beutler Lab
Gene Symbol Tmem131l
Ensembl Gene ENSMUSG00000033767
Gene Nametransmembrane 131 like
SynonymsD930015E06Rik
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0328 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83897655-84040175 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 83921931 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052342] [ENSMUST00000191758] [ENSMUST00000192095]
Predicted Effect probably benign
Transcript: ENSMUST00000052342
SMART Domains Protein: ENSMUSP00000049808
Gene: ENSMUSG00000033767

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:TMEM131_like 91 174 5.8e-20 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191758
SMART Domains Protein: ENSMUSP00000141438
Gene: ENSMUSG00000033767

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 9.2e-10 PFAM
Pfam:DUF3651 285 362 1.5e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192095
SMART Domains Protein: ENSMUSP00000141607
Gene: ENSMUSG00000033767

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 8.8e-10 PFAM
Pfam:DUF3651 285 362 1.4e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 989 996 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194432
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Tmem131l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tmem131l APN 3 83942500 missense probably damaging 0.99
IGL00777:Tmem131l APN 3 83899290 missense probably damaging 1.00
IGL01400:Tmem131l APN 3 83922122 missense probably damaging 0.99
IGL01642:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL01796:Tmem131l APN 3 83938055 nonsense probably null
IGL02055:Tmem131l APN 3 83910366 splice site probably null
IGL02269:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL02806:Tmem131l APN 3 83928816 splice site probably benign
IGL03308:Tmem131l APN 3 83940902 missense probably benign 0.00
IGL03345:Tmem131l APN 3 83961589 missense probably damaging 1.00
R0106:Tmem131l UTSW 3 83934815 splice site probably benign
R0112:Tmem131l UTSW 3 83940587 nonsense probably null
R0212:Tmem131l UTSW 3 83913268 missense probably benign 0.19
R0412:Tmem131l UTSW 3 84031648 missense probably damaging 1.00
R0544:Tmem131l UTSW 3 83898546 missense probably damaging 1.00
R0676:Tmem131l UTSW 3 83934815 splice site probably benign
R0815:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R0826:Tmem131l UTSW 3 83898417 missense probably damaging 1.00
R1432:Tmem131l UTSW 3 83928714 missense probably damaging 1.00
R1582:Tmem131l UTSW 3 83931783 missense probably damaging 0.99
R1591:Tmem131l UTSW 3 83940889 critical splice donor site probably null
R1804:Tmem131l UTSW 3 83910479 missense possibly damaging 0.72
R1875:Tmem131l UTSW 3 83905076 nonsense probably null
R1955:Tmem131l UTSW 3 83961544 missense probably damaging 1.00
R2049:Tmem131l UTSW 3 83942788 missense probably damaging 1.00
R2125:Tmem131l UTSW 3 83942751 critical splice donor site probably null
R2173:Tmem131l UTSW 3 83926145 missense probably damaging 1.00
R2321:Tmem131l UTSW 3 83936023 missense probably damaging 0.98
R2407:Tmem131l UTSW 3 83922048 missense probably benign 0.25
R2917:Tmem131l UTSW 3 83937580 nonsense probably null
R3082:Tmem131l UTSW 3 83909150 critical splice donor site probably null
R3086:Tmem131l UTSW 3 83931739 missense probably benign 0.00
R3773:Tmem131l UTSW 3 83898586 missense probably damaging 1.00
R3921:Tmem131l UTSW 3 83940601 missense possibly damaging 0.68
R3953:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3954:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3956:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R4118:Tmem131l UTSW 3 83960767 missense probably benign 0.00
R4700:Tmem131l UTSW 3 83899212 missense probably benign
R4862:Tmem131l UTSW 3 83898210 splice site probably benign
R4941:Tmem131l UTSW 3 83899239 missense probably benign 0.03
R5101:Tmem131l UTSW 3 83937504 missense probably damaging 0.96
R5290:Tmem131l UTSW 3 83899265 missense probably benign 0.30
R5501:Tmem131l UTSW 3 83926128 missense probably damaging 1.00
R5813:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R5845:Tmem131l UTSW 3 83940553 missense probably damaging 0.99
R5973:Tmem131l UTSW 3 83922246 missense possibly damaging 0.95
R6119:Tmem131l UTSW 3 83898382 missense probably damaging 1.00
R6241:Tmem131l UTSW 3 83922164 missense probably benign 0.06
R6278:Tmem131l UTSW 3 83942491 missense possibly damaging 0.93
R6490:Tmem131l UTSW 3 83913280 missense possibly damaging 0.67
R6502:Tmem131l UTSW 3 83922408 missense probably damaging 1.00
R6503:Tmem131l UTSW 3 83940944 missense probably benign 0.26
R6868:Tmem131l UTSW 3 83961631 missense probably damaging 0.99
R7104:Tmem131l UTSW 3 83919459 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGGAGGATGACTGAACAGTCCTGTG -3'
(R):5'- CAGTGGCATCAATGGCAGCTTG -3'

Sequencing Primer
(F):5'- gctcacaaccatctgtaacaatatc -3'
(R):5'- GTTGTCACTAACACTCCTTCAGAATG -3'
Posted On2013-04-16