Incidental Mutation 'R0112:Tmem131l'
ID20492
Institutional Source Beutler Lab
Gene Symbol Tmem131l
Ensembl Gene ENSMUSG00000033767
Gene Nametransmembrane 131 like
SynonymsD930015E06Rik
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R0112 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location83897655-84040175 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 83940587 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 324 (Q324*)
Ref Sequence ENSEMBL: ENSMUSP00000141607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052342] [ENSMUST00000191758] [ENSMUST00000192095]
Predicted Effect probably null
Transcript: ENSMUST00000052342
AA Change: Q324*
SMART Domains Protein: ENSMUSP00000049808
Gene: ENSMUSG00000033767
AA Change: Q324*

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:TMEM131_like 91 174 5.8e-20 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191758
AA Change: Q324*
SMART Domains Protein: ENSMUSP00000141438
Gene: ENSMUSG00000033767
AA Change: Q324*

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 9.2e-10 PFAM
Pfam:DUF3651 285 362 1.5e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192095
AA Change: Q324*
SMART Domains Protein: ENSMUSP00000141607
Gene: ENSMUSG00000033767
AA Change: Q324*

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 8.8e-10 PFAM
Pfam:DUF3651 285 362 1.4e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 989 996 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194522
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Tmem131l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tmem131l APN 3 83942500 missense probably damaging 0.99
IGL00777:Tmem131l APN 3 83899290 missense probably damaging 1.00
IGL01400:Tmem131l APN 3 83922122 missense probably damaging 0.99
IGL01642:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL01796:Tmem131l APN 3 83938055 nonsense probably null
IGL02055:Tmem131l APN 3 83910366 splice site probably null
IGL02269:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL02806:Tmem131l APN 3 83928816 splice site probably benign
IGL03308:Tmem131l APN 3 83940902 missense probably benign 0.00
IGL03345:Tmem131l APN 3 83961589 missense probably damaging 1.00
R0106:Tmem131l UTSW 3 83934815 splice site probably benign
R0212:Tmem131l UTSW 3 83913268 missense probably benign 0.19
R0328:Tmem131l UTSW 3 83921931 splice site probably benign
R0412:Tmem131l UTSW 3 84031648 missense probably damaging 1.00
R0544:Tmem131l UTSW 3 83898546 missense probably damaging 1.00
R0676:Tmem131l UTSW 3 83934815 splice site probably benign
R0815:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R0826:Tmem131l UTSW 3 83898417 missense probably damaging 1.00
R1432:Tmem131l UTSW 3 83928714 missense probably damaging 1.00
R1582:Tmem131l UTSW 3 83931783 missense probably damaging 0.99
R1591:Tmem131l UTSW 3 83940889 critical splice donor site probably null
R1804:Tmem131l UTSW 3 83910479 missense possibly damaging 0.72
R1875:Tmem131l UTSW 3 83905076 nonsense probably null
R1955:Tmem131l UTSW 3 83961544 missense probably damaging 1.00
R2049:Tmem131l UTSW 3 83942788 missense probably damaging 1.00
R2125:Tmem131l UTSW 3 83942751 critical splice donor site probably null
R2173:Tmem131l UTSW 3 83926145 missense probably damaging 1.00
R2321:Tmem131l UTSW 3 83936023 missense probably damaging 0.98
R2407:Tmem131l UTSW 3 83922048 missense probably benign 0.25
R2917:Tmem131l UTSW 3 83937580 nonsense probably null
R3082:Tmem131l UTSW 3 83909150 critical splice donor site probably null
R3086:Tmem131l UTSW 3 83931739 missense probably benign 0.00
R3773:Tmem131l UTSW 3 83898586 missense probably damaging 1.00
R3921:Tmem131l UTSW 3 83940601 missense possibly damaging 0.68
R3953:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3954:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3956:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R4118:Tmem131l UTSW 3 83960767 missense probably benign 0.00
R4700:Tmem131l UTSW 3 83899212 missense probably benign
R4862:Tmem131l UTSW 3 83898210 splice site probably benign
R4941:Tmem131l UTSW 3 83899239 missense probably benign 0.03
R5101:Tmem131l UTSW 3 83937504 missense probably damaging 0.96
R5290:Tmem131l UTSW 3 83899265 missense probably benign 0.30
R5501:Tmem131l UTSW 3 83926128 missense probably damaging 1.00
R5813:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R5845:Tmem131l UTSW 3 83940553 missense probably damaging 0.99
R5973:Tmem131l UTSW 3 83922246 missense possibly damaging 0.95
R6119:Tmem131l UTSW 3 83898382 missense probably damaging 1.00
R6241:Tmem131l UTSW 3 83922164 missense probably benign 0.06
R6278:Tmem131l UTSW 3 83942491 missense possibly damaging 0.93
R6490:Tmem131l UTSW 3 83913280 missense possibly damaging 0.67
R6502:Tmem131l UTSW 3 83922408 missense probably damaging 1.00
R6503:Tmem131l UTSW 3 83940944 missense probably benign 0.26
R6868:Tmem131l UTSW 3 83961631 missense probably damaging 0.99
R7104:Tmem131l UTSW 3 83919459 missense possibly damaging 0.68
R7736:Tmem131l UTSW 3 83940568 missense probably damaging 0.97
R7885:Tmem131l UTSW 3 83910417 missense possibly damaging 0.89
R8085:Tmem131l UTSW 3 83927131 missense possibly damaging 0.81
R8478:Tmem131l UTSW 3 83898462 missense probably damaging 0.99
Z1177:Tmem131l UTSW 3 84040093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGGCATCCACAGCCACTTTAG -3'
(R):5'- TTTGTGTGAAGACTGTCAGCGCCC -3'

Sequencing Primer
(F):5'- CCAATGGCTTTGGTTTACAGGAAC -3'
(R):5'- AGCGCCCCTTTCTGCTG -3'
Posted On2013-04-11