Incidental Mutation 'R0328:Prpf39'
ID25894
Institutional Source Beutler Lab
Gene Symbol Prpf39
Ensembl Gene ENSMUSG00000035597
Gene Namepre-mRNA processing factor 39
SynonymsSrcs1
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R0328 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location65036333-65063386 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 65043371 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120580] [ENSMUST00000129956] [ENSMUST00000223315] [ENSMUST00000223341]
Predicted Effect probably benign
Transcript: ENSMUST00000120580
SMART Domains Protein: ENSMUSP00000112953
Gene: ENSMUSG00000035597

DomainStartEndE-ValueType
HAT 107 139 3.71e-2 SMART
HAT 141 173 4.39e-4 SMART
HAT 181 216 2.07e0 SMART
HAT 218 251 1.36e2 SMART
low complexity region 277 290 N/A INTRINSIC
Blast:HAT 323 363 6e-18 BLAST
HAT 365 397 3.2e-6 SMART
HAT 398 431 3.21e1 SMART
HAT 505 537 3.63e1 SMART
low complexity region 645 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129956
SMART Domains Protein: ENSMUSP00000114713
Gene: ENSMUSG00000035597

DomainStartEndE-ValueType
Blast:HAT 107 139 7e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223105
Predicted Effect probably benign
Transcript: ENSMUST00000223315
Predicted Effect probably benign
Transcript: ENSMUST00000223341
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Prpf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Prpf39 APN 12 65043263 missense probably damaging 0.99
IGL01025:Prpf39 APN 12 65042481 unclassified probably benign
IGL01323:Prpf39 APN 12 65042724 missense possibly damaging 0.70
IGL02346:Prpf39 APN 12 65057736 missense probably benign 0.02
IGL02966:Prpf39 APN 12 65042779 missense probably benign 0.45
IGL03189:Prpf39 APN 12 65043302 nonsense probably null
IGL03357:Prpf39 APN 12 65061437 unclassified probably benign
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0549:Prpf39 UTSW 12 65056256 missense probably benign 0.05
R0840:Prpf39 UTSW 12 65048206 missense probably benign 0.21
R1248:Prpf39 UTSW 12 65053966 splice site probably benign
R1322:Prpf39 UTSW 12 65042662 missense possibly damaging 0.48
R1481:Prpf39 UTSW 12 65053314 missense probably damaging 1.00
R2209:Prpf39 UTSW 12 65057915 critical splice donor site probably null
R2232:Prpf39 UTSW 12 65044012 nonsense probably null
R2507:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2508:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2959:Prpf39 UTSW 12 65042523 missense probably damaging 1.00
R3117:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3118:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3980:Prpf39 UTSW 12 65061457 unclassified probably benign
R4407:Prpf39 UTSW 12 65056266 missense probably damaging 1.00
R4620:Prpf39 UTSW 12 65042563 missense probably benign
R4926:Prpf39 UTSW 12 65044056 missense possibly damaging 0.90
R5154:Prpf39 UTSW 12 65048277 missense probably benign 0.29
R6248:Prpf39 UTSW 12 65042754 missense probably damaging 1.00
R6334:Prpf39 UTSW 12 65042813 splice site probably null
R6614:Prpf39 UTSW 12 65042563 missense probably benign
R6749:Prpf39 UTSW 12 65056274 missense possibly damaging 0.94
R6944:Prpf39 UTSW 12 65042680 missense probably benign 0.03
R7023:Prpf39 UTSW 12 65053300 missense possibly damaging 0.94
R7503:Prpf39 UTSW 12 65053393 missense probably benign 0.04
R7532:Prpf39 UTSW 12 65053371 missense probably benign 0.00
R7608:Prpf39 UTSW 12 65053446 missense probably benign 0.41
R8286:Prpf39 UTSW 12 65056358 missense probably benign
R8439:Prpf39 UTSW 12 65055262 missense possibly damaging 0.95
R8787:Prpf39 UTSW 12 65042781 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTTGATCCTCAGCTCCAGGGAAGG -3'
(R):5'- GCTTGCACTGCAAAGCTTGACAAAC -3'

Sequencing Primer
(F):5'- ACTGTGCTATTTGACAAAGCTGG -3'
(R):5'- CTGTAGAGGGTTAACGCACCTG -3'
Posted On2013-04-16