Incidental Mutation 'R2888:Aimp2'
ID259990
Institutional Source Beutler Lab
Gene Symbol Aimp2
Ensembl Gene ENSMUSG00000029610
Gene Nameaminoacyl tRNA synthetase complex-interacting multifunctional protein 2
SynonymsAimp2(p38), Jtv1
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143902704-143909847 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 143909735 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031613] [ENSMUST00000100483] [ENSMUST00000110709] [ENSMUST00000148011]
Predicted Effect probably benign
Transcript: ENSMUST00000031613
SMART Domains Protein: ENSMUSP00000031613
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
Pfam:AIMP2_LysRS_bd 1 44 8.3e-26 PFAM
low complexity region 133 142 N/A INTRINSIC
Pfam:GST_C_3 231 308 2.5e-10 PFAM
Pfam:GST_C 242 310 5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100483
SMART Domains Protein: ENSMUSP00000098052
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
low complexity region 93 102 N/A INTRINSIC
Pfam:GST_C_3 185 268 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110707
Predicted Effect probably benign
Transcript: ENSMUST00000110709
SMART Domains Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
MutL_C 277 421 1.59e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147910
Predicted Effect probably benign
Transcript: ENSMUST00000148011
SMART Domains Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
DNA_mis_repair 227 364 4.76e-41 SMART
MutL_C 675 819 1.59e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168085
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the aminoacyl-tRNA synthetase complex, which contains nine different aminoacyl-tRNA synthetases and three non-enzymatic factors. The encoded protein is one of the non-enzymatic factors and is required for assembly and stability of the complex. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele are born with no apparent phenotype but die within 2 days of birth of unknown causes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Aimp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Aimp2 APN 5 143906706 missense probably damaging 1.00
R0630:Aimp2 UTSW 5 143906601 missense probably benign 0.00
R1185:Aimp2 UTSW 5 143904691 missense possibly damaging 0.82
R1185:Aimp2 UTSW 5 143904691 missense possibly damaging 0.82
R1185:Aimp2 UTSW 5 143904691 missense possibly damaging 0.82
R1992:Aimp2 UTSW 5 143906730 missense probably damaging 1.00
R3030:Aimp2 UTSW 5 143906691 missense probably damaging 1.00
R3782:Aimp2 UTSW 5 143906699 missense possibly damaging 0.54
R5510:Aimp2 UTSW 5 143906529 unclassified probably benign
R5689:Aimp2 UTSW 5 143906571 missense possibly damaging 0.51
R8019:Aimp2 UTSW 5 143909594 missense probably benign 0.01
R8777:Aimp2 UTSW 5 143903007 missense probably damaging 0.99
R8777-TAIL:Aimp2 UTSW 5 143903007 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTAGGAGGATTTTGTCGGACC -3'
(R):5'- CGGTGATTGGCCAACTCAAAG -3'

Sequencing Primer
(F):5'- ATTTTGTCGGACCCGGCC -3'
(R):5'- TTGGCCAACTCAAAGGTCAAGTTG -3'
Posted On2015-01-23