Incidental Mutation 'R2888:Myo5b'
ID 260016
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 040476-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.769) question?
Stock # R2888 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 74895689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 1782 (E1782Q)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074157
AA Change: E1756Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: E1756Q

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121875
AA Change: E1782Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: E1782Q

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154986
Meta Mutation Damage Score 0.2237 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 77,414,288 (GRCm39) I338F probably damaging Het
Acd A G 8: 106,425,470 (GRCm39) S288P probably benign Het
Aimp2 T C 5: 143,846,553 (GRCm39) probably benign Het
Atp8b2 T C 3: 89,865,600 (GRCm39) D100G probably damaging Het
Cacna1i A T 15: 80,258,968 (GRCm39) I1226F probably damaging Het
Dsp C A 13: 38,376,224 (GRCm39) N1336K possibly damaging Het
Extl2 T C 3: 115,820,906 (GRCm39) F251S probably damaging Het
Gusb T C 5: 130,029,343 (GRCm39) H146R probably damaging Het
Itpr2 C T 6: 146,072,791 (GRCm39) G2380S probably damaging Het
Kansl1l T C 1: 66,763,764 (GRCm39) K762E probably benign Het
Krtap4-9 C A 11: 99,676,245 (GRCm39) C55* probably null Het
Lamp1 T A 8: 13,223,891 (GRCm39) L341H probably damaging Het
Llcfc1 A T 6: 41,661,537 (GRCm39) K29M probably damaging Het
Malrd1 A T 2: 16,079,568 (GRCm39) I1762F unknown Het
Muc5b G A 7: 141,415,291 (GRCm39) V2746M probably damaging Het
Mug1 T A 6: 121,858,802 (GRCm39) D1173E probably benign Het
Or2t46 T C 11: 58,471,988 (GRCm39) F106S possibly damaging Het
Pcdha5 A G 18: 37,094,940 (GRCm39) D483G probably damaging Het
Phex T C X: 156,093,954 (GRCm39) I439V probably benign Het
Pkd1l1 T A 11: 8,897,251 (GRCm39) S103C probably damaging Het
Plekha4 C T 7: 45,187,668 (GRCm39) R176C probably damaging Het
Ppp1r3a T G 6: 14,718,248 (GRCm39) S889R possibly damaging Het
Pramel23 G T 4: 143,423,460 (GRCm39) T443K probably benign Het
Prol1 C A 5: 88,476,168 (GRCm39) A186E unknown Het
Rbm39 C T 2: 156,009,503 (GRCm39) R123H probably benign Het
Rtn4 T C 11: 29,643,687 (GRCm39) S167P probably damaging Het
Slc35a5 A G 16: 44,971,923 (GRCm39) C114R probably damaging Het
Smoc2 T C 17: 14,617,887 (GRCm39) probably null Het
Sptbn2 A G 19: 4,798,664 (GRCm39) T1998A possibly damaging Het
Tbc1d5 T A 17: 51,242,577 (GRCm39) E173D probably damaging Het
Tsc2 A G 17: 24,850,969 (GRCm39) probably null Het
Umps A T 16: 33,784,240 (GRCm39) V71E probably damaging Het
Vmn2r13 T C 5: 109,339,840 (GRCm39) D45G possibly damaging Het
Wdfy4 C A 14: 32,831,476 (GRCm39) E917* probably null Het
Zfhx2 T C 14: 55,302,260 (GRCm39) K1908R possibly damaging Het
Zfp511 A C 7: 139,619,295 (GRCm39) D204A probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCATCAGACAGGAGCTCAC -3'
(R):5'- GTGTGTGCAGCCAATGTTAC -3'

Sequencing Primer
(F):5'- AGACAGGAGCTCACGCCTC -3'
(R):5'- GTTCCCATACGTTTAAGCAGGAAGC -3'
Posted On 2015-01-23